Labshake search
Citations for Addgene :
801 - 850 of 3415 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and then merged it into the 3’UTR of eGFP expression cascade in LPutopia-7 (Addgene #199212) plasmid ...
-
bioRxiv - Immunology 2024Quote: ... pEMB52-14-3-3_1_247 (γ) was a gift from the Michael J Fox Foundation MJFF (Addgene #40541); pcDNA-HA-14-3-3β (Addgene #13270) ...
-
bioRxiv - Cancer Biology 2024Quote: ... For co-transfection of NT-3 cells with siRNAs and RINS1 plasmid (gift from Dmytro Yushchenko, Addgene plasmid # 107290 ...
-
bioRxiv - Immunology 2024Quote: ... and packaging plamids 7.5 μg of psPAX2 and 3 μg pMD2.G (Addgene plasmids #12260 and #12259). 12 hours after transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... oligonucleotide pairs (Sup. Table 3) were annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410)76 ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with PL-SIN-EOS-C(3+)-EiP (a gift from James Ellis; Addgene #21313) and selected with 1 µg/mL of puromycin (Millipore ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041; http://n2t.net/addgene:55041; RRID:Addgene_55041) constructs (Olenych et al ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2-EF1a-DIO-eNpHR3.0-EYFP-WPRE-pA (4.0 × 1012 vg/mL, 1:2 dilution, UNC vector core using Addgene plasmid #26972 ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2023Quote: We used AAV1-hSyn-GCaMP6f (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:8 to 1:15 in saline) for experiments involving two-photon calcium imaging of V1 layer 2/3 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Pups were injected unilaterally with 1 μl of AAV9-hSyn-DIO-ChrimsonR-mRuby2-ST (2 × 1012 gc ml−1; Addgene #105448) or 1 μl of AAV9-CAG-Flex-ArchT (2 × 1012 gc ml−1 ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Cell Biology 2020Quote: ... a fragment containing the 3×Flag-nls-cas9-nls coding sequence isolated from pBS-Hsp70-cas9 (Addgene, #46294) with same enzymes was inserted ...
-
bioRxiv - Genetics 2021Quote: ... sgRNAs (single gRNA) expressing plasmid was generated using the pCFD3-dU6:3 gRNA vector (Plasmid ID: #49410, Addgene) as described in (Port et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a 3’ untranslated region and terminator sequence (3UTR) from Agrobacterium tumefaciens octopine synthase (AtuOCS) (pICH41432, Addgene #50343). A calibrator construct (pEPYC1CB0197 ...
-
bioRxiv - Immunology 2021Quote: ... an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24 ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al. ...
-
bioRxiv - Cell Biology 2021Quote: tdTomato-ER-3 and LAMP1-Clover (Clover-Lysosomes-20) were gifts from Michael Davidson (Addgene #58097 and #56528). Mito-PhiYFP (pPhi-Yellow-mito ...
-
bioRxiv - Cancer Biology 2023Quote: ... The standard transfection mixture included 3 μg of total DNA [1.5 µg lentiviral plasmid + 1.5 µg helper plasmids - psPAX2 (RRID: Addgene_12260) and pMD2.G (RRID ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898; http://n2t.net/addgene:83898; RRID:Addgene_83898) 51 to express ArchT 67 fused to TS-EYFP-ER sequence that was cloned from a pcDNA3.1 CMV-ChRmine-TS-EYFP-ER plasmid gift of the Hegemann laboratory at the Humboldt Universität ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The lin-3 guide sequence was inserted into pDD162 (eef-1A.1p::Cas9 + empty sgRNA, Addgene plasmid #47549) using Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Neuroscience 2020Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...