Labshake search
Citations for Addgene :
751 - 800 of 3415 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710). After 48 hours ...
-
bioRxiv - Physiology 2021Quote: EGFP-hArgonaute-2 (eGFP-Ago2) was purchased from (Addgene plasmid # 21981) and was prepared in the laboratory of Philip Sharp (MIT) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV1-flex-ChR2-Tdtomato (Addgene, titer 2*1012/ml, 0.5 μl) or AAV1-flex-ChR2-mCherry (Charite Vector core ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cell Biology 2020Quote: Plasmids for biosensors were purchased from Addgene (see Supplementary Table 2). ERKKTR ...
-
bioRxiv - Cell Biology 2021Quote: ... and the three injection markers pCFJ90 (Pmyo-2::mCherry, Addgene #19327), pCFJ104 (Pmyo-3::mCherry ...
-
bioRxiv - Neuroscience 2022Quote: pAAV2/2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362, Roth Lab) was injected intraocularly in VGluT3-Cre mice ...
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µg pSPAX2 (a kind gift from Didier Trono; Addgene #12260), and 2 µg of pcDNA3- SΔ19 with PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 μg pMD2.G envelope plasmid (plasmid #12259; Addgene, Teddington, UK), and 12 μg of the pLJM1 vector for overexpression (plasmid #19319 ...
-
bioRxiv - Genetics 2020Quote: ... Lentiviral particles were generated in 293T cells using pMDG.2 (Addgene) and psPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: The Capture sequence 2 was added to the gRNA_Purp_Backbone (Addgene #73797) by PCR ...
-
bioRxiv - Neuroscience 2022Quote: [2] piggyBac backbone from pBAC-ECFP-15xQUAS_TATA-SV40 (Addgene, ID #104875) (Riabinina et al. ...
-
bioRxiv - Microbiology 2024Quote: ... pcDNA3.1-Ha-Dynamin 2.K44A (gift of S. Schmid, Addgene 34685), pEGFPC1 (Clontech) ...
-
bioRxiv - Microbiology 2024Quote: ... pEGFP-Dynamin 2.K44A (gift of P. De Camilli; Addgene 22301), and pEGFP-Dynamin 2ΔPRD (50 ...
-
bioRxiv - Neuroscience 2024Quote: ... driven by synapsin promoter (Addgene, 100843-AAV9, 2×109 vg/coverslip) (20) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of plasmid expressing CRISPR-Cas9 and guide (Addgene #42230) and 40 pmol ssDNA repair template were transfected using Lipofectamine 3000 (Invitrogen L3000001 ...
-
bioRxiv - Microbiology 2023Quote: ... and cloned into UC Berkeley Macrolab vector 2-CT (Addgene #29706), which encodes an N-terminal TEV protease cleavable His6-MBP (maltose binding protein ...
-
bioRxiv - Developmental Biology 2023Quote: ... and pBS-KS-attB2-SA(2)-T2A-p65AD-Hsp70 (Addgene #62915). The integration orientation of yellow progenies from MiMIC injection and 3xP3-GFP-progenies from CRIMIC injection were confirmed by PCR genotyping ...
-
bioRxiv - Systems Biology 2023Quote: ... Each promoter was then cloned into the pMW#2 (Addgene #13349) and pMW#3 (Addgene #13350 ...
-
bioRxiv - Microbiology 2023Quote: ... 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259) and 2 mg Gag-Pol expression vector psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951; http://n2t.net/addgene:154951; RRID:Addgene_154951)32 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509; http://n2t.net/addgene:51509; RRID:Addgene_51509)55.
-
bioRxiv - Cell Biology 2024Quote: ... and marker pCFJ90 (Pmyo-2-mCherry; Addgene #19327, 2.5 ng/µL) was injected into N2 young adult hermaphrodites ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pDONR207 SARS-CoV-2 nsp1 R124A/K125A (M2, Addgene #164523) plasmids using the primers 5-EX-NSP1 and 3-NB-NSP1 and cloned into pEGFP-N1 digested with EcoRI and NotI enzymes ...
-
bioRxiv - Neuroscience 2024Quote: ... Each sgRNA was cloned into pU6-2-sgRNA-short (Addgene 41700) plasmid and two plasmids were co-injected into vas-Cas9 line (BDSC # 51324 ...
-
bioRxiv - Bioengineering 2024Quote: ... and [2] pRSV-Rev was a gift from Didier Trono (Addgene plasmid 12253 ...
-
bioRxiv - Biochemistry 2024Quote: The Cilantro 2 reporter vector (PGK.BsmBICloneSite-10aaFlexibleLinker-eGFP.IRES.mCherry. cppt.EF1α.PuroR, Addgene #74450) was used for flow-based degradation assays ...
-
bioRxiv - Cancer Biology 2024Quote: U□2 OS cells transfected with pDR-GFP plasmid (Addgene, 26475) using GenJet (SignaGen Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: The Cilantro 2 reporter vector (PGK.BsmBICloneSite-10aaFlexibleLinker-eGFP.IRES.mCherry. cppt.EF1α.PuroR, Addgene 74450) was used for flow-based degradation assays ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 μg of pMD2.G (Addgene plasmid #12259, from Trono lab) and 6 μg of psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2024Quote: ... and pCI-neo-CHIKV or pMD2.G (2 μg, Addgene #12259) using polyethylenimine (PEI ...
-
bioRxiv - Cell Biology 2022Quote: ... Dynamin 2-mTFP1 (or dynamin 1-mTFP1) construct was created by replacing the EGFP tag of dynamin 2-EGFP (or dynamin 1-EGFP, Addgene) with mTFP1 (Addgene) ...
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Molecular Biology 2021Quote: ... pYM-N2339 and pFA6a-hphMX-(3×FLAG)-TEV-ProtA (gift from Michael Nick Boddy, Addgene plasmid # 52692).
-
bioRxiv - Molecular Biology 2020Quote: ... mEmerald-ER-3 was a gift from Michael Davidson (Addgene plasmid # 54082; http://n2t.net/addgene:54082; RRID:Addgene_54082). Cells were seeded on high precision coverslips (Marienfeld ...
-
bioRxiv - Cell Biology 2021Quote: ... GST Tat was generated by cloning pNL4-3 derived tat gene in pGEX-4T1 vector from Addgene. HA Tat and Flag NQO1 were purchased from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328; http://n2t.net/addgene:19328; RRID:Addgene_19328); 100 ng/µl of a construct expressing Cas9 and a sgRNA targeting the sequence ACATGAGTCTGTGTTTACGG (derived from pDD162 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 106 HEK293T cells were transfected using GenJet transfection reagent (Signagen) with 7.5 µg psPax2 (Addgene #12260), 5 µg VSV-G (pMD2.G ...
-
bioRxiv - Neuroscience 2020Quote: A Nectin-3 overexpression construct was created by modifying a pCag-iCre expression vector (Addgene plasmid # 89573). Nectin-3 alpha was PCR amplified (KOD hot start DNA polymerase ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were reverse-transfected with 3 plasmids: psPAX2 (a gift from Didier Trono, Addgene #12260), pEGFP-Vpr (obtained through the NIH HIV Reagent Program ...
-
bioRxiv - Molecular Biology 2022Quote: pET21b-Caspase-3-His6 and pET21b-Caspase-7-His6 were gifts from Clay Clark (Addgene plasmid #90087) and Guy Salvesen (Addgene plasmid #11825) ...
-
bioRxiv - Microbiology 2022Quote: ... RSAD2 forward 5’ caccgAGTGGTAATTGACGCTGGTG 3’ and reverse 5’ aaacCACCAGCGTCAATTACCACTc 3’) were designed using CHOPCHOP web tool (https://chopchop.cbu.uib.no/) and cloned into pLentiCRISPR v2 vector (Addgene) as described [92 ...
-
bioRxiv - Microbiology 2024Quote: The full-length HIV vectors NL4-3 ΔEnv EGFP (HIV Reagent Program) and HIVGKO (Addgene plasmid #112234) were produced in HEK293T cells along with the VSV-G (Addgene plasmid # 8454 ...
-
bioRxiv - Genetics 2023Quote: ... pCFD4-U6:1_U6:3 was a gift from Simon Bullock (Addgene plasmid #49411; http://n2t.net/addgene:49411; RRID:Addgene_49411). His3.3A reference sequence ...
-
bioRxiv - Genomics 2023Quote: ... vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719; http://n2t.net/addgene:44719; RRID:Addgene_44719) (Ding et al ...
-
bioRxiv - Neuroscience 2023Quote: Cortical neurons control and VPS50 mKO were co-infected at 3 DIV with GCaMP7f (Addgene Cat#104488). At 10 DIV ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...