Labshake search
Citations for Addgene :
651 - 700 of 3014 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... together with psPAX-2 (Addgene plasmid #12260) and pMD2.G (Addgene plasmid #12259) ...
-
bioRxiv - Microbiology 2023Quote: ... pDONR223 SARS-CoV-2 spike (Addgene #149329), B.1.1.7 SARS-CoV-2 spike (Sino Biological ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-FKBP-GFP-OPTN (2-119) (RRID:Addgene_208867), pHAGE-mt-mKeima-P2A-FRB-Fis1 (RRID:Addgene_135295).
-
bioRxiv - Genetics 2024Quote: ... pMXs.hSox2 (SRY-Box Transcription Factor 2, RRID:Addgene_17218), pMXs.hKlf4 (Kruppel Like Factor 4RRID:Addgene_17219) ...
-
bioRxiv - Microbiology 2024Quote: ... we used pcDNA3-GFP-IMP2-2 (Addgene plasmid # 42175 ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of psPAX.2 (Addgene, #12260), and 3 µg of sgRNA plasmid into HEK293T cells seeded in 6-well plates at 70% confluence using jetPRIME transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... 2.) piRES-puro vector (Addgene Cat# 25728) with EcoRI and NotI sites for site-directed mutagenesis experiments.
-
bioRxiv - Immunology 2021Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vectors 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) or 2C-T (AmpR ...
-
bioRxiv - Bioengineering 2021Quote: The gene encoding yqjM was cloned under the T7 promoter in-frame with an N-terminal 6x HisTag of the p15TvL expression vector (AddGene: 26093) using the In-Fusion@HD EcoDry kit ...
-
bioRxiv - Cell Biology 2021Quote: These constructs were subcloned via PCR from the corresponding squ-mNeongreen-RhoGEF2 full length constructs into pGEX6P1-N-HA (Andrew Jackson and Martin Reijns, Addgene 119756).
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2021Quote: ... The expression vector for N-terminally FLAG-tagged mouse SYDE2 was generated by PCR amplification of the coding sequence from pNICE HA-mSYD1B (Addgene #59362) and insertion into pcDNA3-FLAG by Gibson assembly.
-
bioRxiv - Neuroscience 2020Quote: ... trkB.DN-mCherry was inserted between the two double floxed sites in the pAAV-EF1a-DIO plasmid backbone (Addgene plasmid n°20949), using NheI and AscI as restriction enzyme cloning sites ...
-
bioRxiv - Bioengineering 2020Quote: ... The ScFv library with the N-terminal CD8α signal peptide was fused to the synNotch-Gal4VP64 receptor backbone (Addgene plasmid #79125) in place of the CD19-specific scFv ...
-
bioRxiv - Biophysics 2020Quote: ... was expressed in E.coli using gene with an N-terminal 6XHis-tag and up stream TEV-protease site cloned into pET28a(+) (Addgene plasmid #2006150). MSP1D1 was purified using IMAC72 with further cleavage of 6xHis-tag by TEV protease (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... It was constructed by subcloning annealed oligonucleotides #912 and #913 into the pLentiLox3.7 lentiviral vector (plasmid #627) (Addgene cat. n°11795) opened with HpaI and XhoI ...
-
bioRxiv - Biochemistry 2022Quote: ... Full-length human KRAS4B G12C was ectopically expressed from the retroviral expression vector pBABE containing an N-terminal HA-tag (Addgene #58901). Viral particles were generated by transient transfection of each expression vector into HEK 293T cells using Fugene6 (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... and AP5Z1 cDNA was transferred by LR clonase into the pDest-53 or the pDEST-CMV-N-Tandem-mCherry-EGFP vector (Addgene #123216), respectively ...
-
bioRxiv - Immunology 2020Quote: ... Human orfeome clone 10217) was gateway cloned into an attR-destination vector encoding an N-terminal FLAG tag (Addgene, Plasmid #18700), with the Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... and the control group (n = 10) received injections of AAV5-CaMKIIa-EGFP (titer 4.3×10^12 GC/ml; Addgene, MA, USA). The injection coordinates and volumes for the three injections made into the anterior cingulate cortex were as follows ...
-
bioRxiv - Neuroscience 2020Quote: ... the experimental group (n = 12) received injections of AAV5-CaMKIIa-hM4Di-mCherry (titer 4.4×10^12 GC/ml; Addgene, MA, USA;) and the control group (n = 10 ...
-
bioRxiv - Biophysics 2022Quote: ... The following expression vectors were used for plasmid DNA transfections: pCMV-mEmerald-FilaminA-N-9 (Addgene #54098, gift from Michael Davidson), pCMV-mCherry-FilaminA-N-9 (Addgene #55047 ...
-
bioRxiv - Cell Biology 2021Quote: ... we used an existing construct Posm-5::xbx-1::yfp 53 and replaced the xbx-1::yfp insert with an mito::gfp insert (encoding for a C-terminal GFP fused to an N-terminal mitochondria-targeting sequence) amplified from the Andrew Fire vector pPD96.32 (Plasmid #1504, Addgene, Cambridge, MA). The resulting plasmid Posm-5::mito::gfp was coinjected with the roller marker pRF4(rol-6(su1006) ...
-
bioRxiv - Neuroscience 2021Quote: Full-length human APLP1 gene with a Flag tag in the N-terminal was cloned from pCAX APLP1 (Addgene plasmid#30141) and the primers were shown in Key Resources Table (NheI-Flg-hAPLP1-F/XhoI-His-hAPLP1-R) ...
-
bioRxiv - Biochemistry 2020Quote: ... N3 (residues 365-419) was similarly inserted into UC Berkeley Macrolab vector 2C-T (AmpR, N-terminal His6-MBP fusion; Addgene #29706). Plasmids were transformed into E ...
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2022Quote: ... The pHUJI-LC3B construct was cloned by inserting a codon-optimized gblock encoding pHUJI fused to the N-terminus of human LC3B into the NotI site of pENTR4 (Addgene #17424), and then Gateway-recombined with LR clonase II (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments are then cloned into a mammalian expression vector containing Flag and mEGFP (N- or C-terminal) (modified from Addgene #32104) using NEBuilder HiFi DNA Assembly kit (E2611) ...
-
bioRxiv - Molecular Biology 2024Quote: ... we cloned N-terminally StrepII-tagged JetA (C36A, C355A) and untagged JetB into UC Berkeley Macrolab vector 13S-A (Addgene # 48323). To generate truncated JetA constructs ...
-
bioRxiv - Microbiology 2024Quote: ... The new product replaced an existing gene when inserted into pcDNA3.1 containing a triple N-FLAG-tag between KpnI and EcoRI (Addgene plasmid #67788). The GFP transfection control plasmid ...
-
bioRxiv - Cancer Biology 2024Quote: ... the NINJ1 cDNA from pENTR223-NINJ1 (DNASU, HsCD00505254) and SLC7A11 cDNA from pENTR223-SLC7A11 (DNASU, HsCD00512940) were individually subcloned into pLVpuro-CMV-N-EGFP (Addgene, #122848) and pLVpuro-CMV-N-mCherry (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and HA-tag were introduced by CRISPR/Cas9-mediated homologous recombination to the N-terminus of ZBTB24 protein (gRNAs are listed in Table S9 were cloned in pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138), the plasmids containing HA tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice were generated by subcloning an N-terminal 3x HA-tagged CIC-DUX4 fusion gene from Yoshimoto et al.6 into a Rosa26 targeting construct (Addgene #21714). The sequence verified construct was then transfected into ES cells and selected in G418 media ...
-
bioRxiv - Neuroscience 2024Quote: ... the USP14 entry clone from the human ORFeome collaboration library was used to perform mutagenesis and the constructs obtained were transferred into the 2Flag-pDEST-N (118371, Addgene, USA) vector using standard reaction protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... with SNAP-tag proteins fused in-between Aga2p-HA-tag (N-terminal) and cMyc-tag (C-terminal) or a pJYDNg vector (Addgene, #162452) with a C-terminal fusion to Aga2p-HA-tag-cMyc-tag-eUnaG2 was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... and pCEBZ-Flag-GST-PLAT expressing various N-terminally Flag-tagged proteases were generated by PCR amplification of the respective sequences from the plasmids pDONR223-furin (Addgene #82122), p-hCathepsin L (Addgene #11250) ...
-
bioRxiv - Molecular Biology 2024Quote: pLEX-FLAG-Cre-GFP was generated by cloning PCR-amplified N-terminal FLAG tagged Cre-GFP (from pCAG-Cre-GFP; Addgene #13776) (Forward primer ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR product was digested with XbaI and cloned into the XbaI site of the pTrex-n-eGFP plasmid (ADDGENE: #62544). LpBBS1 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression vectors encoding an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666) or an N-terminal TEV protease-cleavable His6-maltose binding protein tag (UC Berkeley Macrolab vector 2C-T ...
-
bioRxiv - Biochemistry 2024Quote: ... or an N-terminal TEV protease-cleavable His6-maltose binding protein tag (UC Berkeley Macrolab vector 2C-T, Addgene ID 29706). Vectors were transformed into E ...
-
bioRxiv - Biochemistry 2024Quote: ... coli expression vectors encoding an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T, Addgene ID 29666) or His6-MBP-tag (UC Berkeley Macrolab vector 2C-T ...
-
bioRxiv - Cell Biology 2020Quote: ... SKO cells were transfected with pSH-EFIRES-P-GFP(1-10)opti AAVS1 Safe Harbor integration plasmid (Addgene plasmid # 129416, [35] and pCas9-sgAAVS1-2 (Addgene plasmid # 129727 [47]), and a stable pool was selected using puromycin (1 µg/ml puromycin for 6 days ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Cell Biology 2023Quote: ... and EBP50-PDZ12 (aa 1-298) cloned into the pCMV-2-FLAG vector were gifts from Maria-Magdalena Georgescu (Addgene plasmids #28291-28297).
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...