Labshake search
Citations for Addgene :
451 - 500 of 3014 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2-5 were obtained from Addgene. pHelper plasmid was a gift from Matthew Banghart at the University of California ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1.hSyn.Flex.GCaMP6f.WPRE.SV40 (5 x 1012GC/mL, Addgene) was used to detect calcium (Ca2+ ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µg pMD2.g (Addgene, 12259) combined with 1.8 mL Opti-MEM medium (Gibco ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 µg of ATP1A1_plasmid_donor_RD (Addgene plasmid, #86551), and 2.5 µl ssODN donor (100 µM) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µg pMD2.G (Addgene #12259) were co-transfected into HEK 293T/17 cells (ATCC # CRL-11268 ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Plant Biology 2024Quote: ... the AtTRXh5 and OsHIPP43-HMA level 0 modules were cloned into the level 1 binary acceptor plasmid pICH47732 with pICSL13001 (long 35s CaMV promoter + 5’ untranslated leader, Addgene no. 50265), pICSL30009 (4xMyc N-terminal tag ...
-
bioRxiv - Neuroscience 2024Quote: ... titer ≥ 1*1013 vg/mL), AAV2/5-gfaABC1D-tdTomato (44332-AAV5, titer ≥ 7*1012 vg/mL) were sourced from Addgene (https://www.addgene.org/). AAV2/9-GFAP-eGFP-Cre (titer ≥ 2.5*1010 vg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse N-terminal Flag-tagged TRAF6 (Flag-TRAF6) mammalian expression plasmid was purchased from Addgene (#21624, GenBank: BAA12705.1). N-terminally GST-tagged TRAF6 (GST-TRAF6 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MApple-LC-Myosin-N-7 was a gift from Michael Davidson (Addgene plasmid 54920; http://n2t.net/addgene : 54920; RRID : Addgene_54920). The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967 ...
-
bioRxiv - Genomics 2021Quote: Individual effectors were fused at the N-terminus to the PYL1 domain (gift from Jerry Crabtree, Addgene plasmid #38247) and sfGFP ...
-
bioRxiv - Biochemistry 2021Quote: ... pLPC-puro-N-Flag was a gift from Titia de Lange (Addgene plasmid # 12521; http://n2t.net/addgene:12521; RRID: Addgene_12521). The pLPC-puro-N-Flag-NELFE plasmid was obtained by amplification of the human NELFE cDNA (obtained from gene synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... Gateway recombination of the destination vector pLVpuro-CMV-N-APEX2-EGFP with the entry clone pDONR223 LC3B WT (Addgene plasmid # 123072 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pGL3-U6-sgRNA-PGK-puromycin and pST1374-N-NLS-flag-linker-Cas9-D10A were gifts from Xingxu Huang (Addgene plasmid # 51133 ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Neuroscience 2022Quote: ... PV mice (n=9) were infused with AAV9-CAG-FLEX-SomArchon-GFP (titer: 6.3×1012 – 1.1×1013 GC/mL, Addgene #126943) or AAV9-synapsin-FLEX-SomArchon-GFP (titer ...
-
bioRxiv - Neuroscience 2022Quote: ... Most CaMKII mice (n=4) were infused with AAV9-CaMKII-SomArchon-GFP (titer: 3.2×1012 GC/mL, Addgene #126942), and one CaMKII mouse was infused with AAV9-synapsin-SomArchon-GFP (titer ...
-
bioRxiv - Cell Biology 2024Quote: ... enables GFP and APEX to be targeted to cilia in many cell types via the N-terminal 203 residues of NPHP3 and was a gift from Maxence Nachury (RRID:Addgene_73186) (Mick et al ...
-
bioRxiv - Neuroscience 2023Quote: ... Rats intended for fiber photometry experiments (n=11 females) received unilateral infusions of AAV9 FLEX-GCaMP6f (0.4uL, titer ∼1.4 × 1013 GC/mL, Addgene #100833) into the VP and retro-AAV Cre (0.4uL ...
-
bioRxiv - Cell Biology 2023Quote: ... Human NDP52 cDNA was cloned into a pGST2 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_187828). After the transformation of the pGST2 vector encoding GST-TEV-NDP52 in E ...
-
bioRxiv - Biochemistry 2023Quote: ... Linker SAM variants with N terminal HisSUMO-tag were assembled in a pET vector (starting from Addgene Plasmid #111559) for recombinant expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... from where it was subcloned into a pGEX-4T1 vector with an N-terminal GST tag followed by a TEV cleavage site (RRID:Addgene_208870). For expression of unlabeled NAP1 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a pGEX-4T1 vector with an N-terminal MBP-tag followed by a TEV cleavage site before wild-type NAP1 (RRID:Addgene_208871), NAP1 delta-NDP52 (S37K/A44E ...
-
bioRxiv - Physiology 2024Quote: ... the AAV9-TNT-MCM2 vector was created by amplifying MCM2 cDNA from mEmerald-MCM2- N-22 (Addgene ID: 54164) using forward primer ...
-
bioRxiv - Cell Biology 2024Quote: ... the C-terminal domain of FIP200 (1429-1591aa) was fused to a N-terminal 6xHis-TEV-GFP-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223724). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-GFP-FIP200(CTR ...
-
bioRxiv - Cell Biology 2024Quote: ... the protein phosphatase was fused to a N-terminal 6xHis-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223747). After the transformation of the pET-DUET1 vector encoding 6xHis-TEV-λ PPase in E ...
-
bioRxiv - Cell Biology 2024Quote: ... or ATG13 (230-517aa) were fused to a N-terminal 6xHis-TEV-mCherry-tag through cloning into a pET-DUET1 vector (RRID:Addgene_223762) or by inserting the coding sequence for ATG13 (191-517aa) ...
-
bioRxiv - Cell Biology 2024Quote: ... A donor repair template (backbone C-terminal tagging: pHD-DsRed - Addgene #51434; backbone N-terminal tagging: pUC19-Addgene #50005) carrying the tag as well as a loxP-DsRed-loxP eye marker cassette flanked by 600-1000 bp homology regions up- and downstream of the start codons (for N-terminally tagged mCherry::Nup358 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1/5-CamKIIahChR2(H134R)-eYFP or AAV1/5-CamKIIa-eYFP (AAV5: from UNC GTC Vectore Core; AAV1: from Addgene) was injected bilaterally in mPFC under stereotaxic guidance at 2.2 mm anterior and 0.3 mm lateral to bregma and 1.6 mm ventral to the skull ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Molecular Biology 2021Quote: ... For mutagenesis of the two SIMs in sov two pairs of sgRNAs (1+4 and 3+2) were cloned into pCFD4d (Addgene 83954) (Ge et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Neuroscience 2021Quote: Voltron2 and Channelrhodopsin2 were expressed throughout the motor cortex using injections of a mixture of (1) rAAVretro-hSyn-Cre-WPRE (2×109 g.c.; Addgene #105553-AAVrg), (2 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293T cells were transfected using Fugene HD transfection reagent in a 3:1 reagent : DNA ratio with packaging plasmid 2 µg psPAX2 (a gift from Didier Trono, Addgene, #12260), 1 µg murine ecotropic envelope plasmid pEnv(eco)-IRES-puro (Morita et al ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Plant Biology 2023Quote: ... All four Level 1 cassettes were assembled in a one-step reaction into the Level 2 acceptor plasmid (pAGM4723 Addgene #48015) as previously described (Dudley et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... The HTR8 cells with mir-218 KO were generated by cloning gRNAs that target mir-218-1 and mir-218-2 into a CRISPR/Cas9 vector PX459 (Addgene #62988). The plasmid was verified by sequencing ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Microbiology 2023Quote: ... HUDEP-2 were transduced at an MOI <1 with lentivirus prepared from pXPR_101 (lentiCas9-blast, gift from Feng Zhang, Addgene plasmid 52962) and selected with blasticidin ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2024Quote: Guide RNA (gRNA) sequences targeting neutral sphingomyelinases 1 & 2 and Rab27s a and b were cloned into a lentiCRISPR vector (Addgene (52961) 45 ...
-
bioRxiv - Genetics 2024Quote: ... To determine MOI and approximation of appropriate viral volume we infected day 14 iGLUTs (0, 1, 2, 4, 8, 10, 16, 32, 64 µL) with control lentivirus (pLS-SV40-mP-EGFP; AddGene #137724) and harvested for 48hrs later ...
-
bioRxiv - Neuroscience 2024Quote: ... and two sgRNA targeting sequences against BORCS7 (1: CGCGATTACGTCAGTACCAC, 2: GATTACGTCAGTACCACAGG) were cloned into the lenti-CRISPR v2 plasmid (Addgene 52961) following the Zhang Lab protocol (https://media.addgene.org/data/plasmids/52/52961/52961-attachment_B3xTwla0bkYD.pdf) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV9-hSyn-GRABNE2h was co- injected with AAV9-CAG-tdTomato (stocks at 1-2 x 1013 copies/mL, Addgene, #59462-AAV9).