Labshake search
Citations for Addgene :
651 - 700 of 725 citations for Alpha Cyclodextrin Solution 5% w v since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... gBlocks were created for this sequence with a C-terminal “LPETG” Sortase recognition site and complementary 5’ and 3’ overhangs to the BamHI/HindIII double digested pCARSF63 Thioredoxin-SUMO fusion expression plasmid (Addgene #64695).89 The resulting gBlocks were ligated into pCARSF63 expression plasmids using Gibson assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Genomics 2024Quote: ... respectively),25 modified scaffold sequence was 5′GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGC,60 and RNA structural motif for epegRNAs was tevopreQ1 (5′-CGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAA).40 pegRNAs and epegRNAs used the pU6-sgRNA-EF1Alpha-puro-T2A-BFP (Addgene #60955)35 backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... 25 μg of pT/Caggs-NRASV12 or pT/Caggs-NRASV12/D38A and 5 μg of PT2/c-Luc//PGK-SB-13 (Addgene, 20207) were suspended in 0.9% saline solution at a final volume of 10% of the body weight and injected via the tail vein within 8 seconds ...
-
bioRxiv - Neuroscience 2023Quote: ... Two gRNA spacer sequence targeting the 5’UTR immediately before the start codon of gcm were first cloned into pAC-U63-tgRNA-nlsBFPnls (Addgene 169029) (78 ...
-
bioRxiv - Cell Biology 2023Quote: The PM-targeting sequence MyrPalm was amplified by PCR and ligated at the 5’ of the cameleon D1cpv-encoding sequence (Addgene #37479) into pcDNA3.
-
bioRxiv - Cancer Biology 2023Quote: ... or FAXDC2 sg RNAs (sg3 5’-TCTTGTTCTACTATTCACAC-3’, sg4-TGGGGAAAGATATCATGCAC-3’) were cloned into was cloned into FgH1tUTG or FgH1tUTCyan plasmid (Addgene #85551) plasmids respectively ...
-
bioRxiv - Immunology 2023Quote: ... the gRNA oligonucleotides against murine mesothelin (5’- ATGTGGATGTACTCCCACGG-3’) (synthesized by Dr. Genewiz, MA, USA) were cloned into lentiCRISPRv2 hygro vector (Addgene# 98291) as previously reported55 ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... the guide sequence 5’- GCCCCCAGCCTCTGCGG-3’ was cloned into the vector pSpCas9(BB)-2A-eGFP (PX458 plasmid a gift from Feng Zhang, Addgene #48138). Homology directed repair templates were designed to contain 1000bp homology arms flanking the region to be edited ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Plant Biology 2023Quote: ... and MOM1 CMM2 domain (aa1660-aa1860)5 were first cloned into gateway entry vectors followed by LR reaction with pGBKT7-GW (Addgene 61703) and pGADT7-GW (Addgene 61702 ...
-
bioRxiv - Cell Biology 2023Quote: ... PH-FFAT/N-PH-FFAT sequences (5’-NheI/3’-AscI) were amplified by PCR from pLJM1-FLAG-GFP-OSBP plasmid (Addgene#134659). The sequences encoding Twitch (Twitch2b/Twitch7x/Twitch8x/Twitch9x ...
-
bioRxiv - Cell Biology 2023Quote: ... and NEFL knock-in (5’ – GTAGCTGAAGGAACTCATGG – 3’) were designed by DESKGEN tool and subcloned into pSpCas9(BB)-2A-GFP (Addgene, 48138) with BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... bound to FOXM1-chDNA1 or gRNAs (5’-GCA GGC AGA GCG TAA GCA AA-3’ and 5’-GGA CAC ACG TTT AAT CGA GT-3’) bound to FOXM1-chDNA3 was cloned into the pX335 vector (Addgene, 42335) before the gRNA scaffold ...
-
bioRxiv - Plant Biology 2023Quote: ... The construct contains a Cas9 expression cassette driven by the CaMV 2×35S promoter and 5’UTR and guide RNA (Ueta et al. 2017) scaffold driven by the AtU6 promoter (Kamoun Lab, Addgene #46968). The AtU6-gRNA-7xT fragment was cloned into level-1 plasmid (SlIAA9-gRNA3 ...
-
bioRxiv - Microbiology 2023Quote: ... lentiviral particles pseudotyped with the VSV-G protein were produced by cotransfecting HEK293T cells in 10cm dishes with 5 mg pLentiCMVPuroDEST vector (Addgene, #17452), 2 mg VSV-G Env expression vector pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... The guide RNA targeting sequence 5’- TGGTCGTGGATACGAGAAGA-3’ was inserted into the Peft-3>Cas9 + sgRNA plasmid pDD162 [12] (Addgene #47549) using a Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Cell Biology 2024Quote: ... These were amplified by two miR-E universal primers (fwd 5′-CTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGA CAGTGAGCG-3′) (rev 5′-ACAAGATAATTGCTCGAATTCTAGCCCCTTGAAGTCCGAGGCAGT AGGCA-3′) and cloned into the XhoI and EcoRI double digested LT3GEPIR lentiviral vector (Addgene #111177). HEK293T cells were transfected with these vectors to produce lentivirus which was then used to transduce lamin TKO mESCs ...
-
bioRxiv - Cell Biology 2024Quote: PINK1 KO cells were generated using CRISPR-Cas9 with a PINK1 targeting sgRNA (5’-CACCGTACCCAGAAAAGCAAGCCG-3’) cloned into pU6-(BbsI)-CBh-Cas9-T2A-mCherry (Addgene, #64324). This plasmid was transfected into hTERT-RPE1 Flp-In TREX cells followed 24 h later by fluorescence-activated cell sorting (FACS ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells with lentiviruses of I-SceI or Cas9WT or Cas9D10A along with gRNA (5’-GTAGGAATTCAGTTACGCT) from the Cas9WT vector derived from lentiCRISPR V2 (Addgene, #52961) or the Cas9D10A vector 19 ...
-
bioRxiv - Cancer Biology 2024Quote: 293T cells (1.5 x 106 cells in a 10-cm dish) were transfected with the pCDH-puro-CMV-VC3AI lentiviral vector (Addgene, 78907) using Lipofectamine 2000 ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 nl of adeno-associated viruses (pAAV-hSyn-DIO-EGFP at titer 1,5 x 10*8; Addgene 50457-AAVrg or retrograde hSyn-DIO- mCherry at titer 3,75 x 10*8; Addgene 50459-AAVrg) were stereotactically injected into the CeA (coordinates from bregma ...
-
bioRxiv - Genetics 2024Quote: ... with an HA-tag sequence fused to its 5’ end was cloned into a PiggyBac vector (pPB-CAG-3xFLAG-empty-pgk-hph, Addgene, #48754) to create pPB-CAG-3xFLAG-HA-PATZ1-pgk-hph plasmid via Gibson assembly (NEB ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 5’-AATTGAGCTCGATGAGCGGCCTGGTGC-3’ and rev: 5’- AATTGGATCCTTATTGCGAGTACACCAATTCATTCATG-3’ and inserted between SalI and BamHI sites of pQE-80L MBP-SspB Nano plasmid (Addgene #60409) by using restriction digestion and T4 ligase ligation process.
-
bioRxiv - Synthetic Biology 2024Quote: ... 5’- GTATTTTCAGGGATCGCCGCTAGCGCTACCGG-3’ and rev: 5’-TCGGGGAGCTGGATCCTCCGCCAGCGCTGC-3’ and inserted into BamHI site of pQE-80L MBP-SspB Nano plasmid (Addgene #60409) by using Gibson assembly ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2 (sgRNA-GALC2: 5’ TACGTGCTCGACGACTCCGA 3’) were subcloned individually into pX459 v2.0 (gift from Dr. Feng Zhang, Addgene plasmid #6298832). GALC targeting sequences were further tested by the Off-Spotter software to minimize potential off target effect ...
-
bioRxiv - Cancer Biology 2024Quote: ... a human VEGFC target oligonucleotide (5′-GAGTCATGAGTTCATCTACAC-3′) was cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene plasmid # 42230). Two VEGFCKO clones were obtained by PEI transfection (Tebu Bio ...
-
bioRxiv - Genetics 2024Quote: ... targeting the 5’ and 3’ ends of the ao gene into pCFD4 U6:1_U6:3tandemgRNAs (Port et al. 2014; Addgene plasmid #49411). The repair template sequence ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2020Quote: ... targeting the 5’ (5’-AGTGCGCTTCGTCACTGCAC-3’) and 3’ (5’-TCCTCCCGCCCCGACGCGGA-3’) region of the Spen ORF were cloned in the Cas9-GFP pX458 vector (Addgene plasmid #48138). Compatible 5’ and 3’ Homology arms (HA ...
-
bioRxiv - Developmental Biology 2020Quote: ... a sgRNA targeting the 3’ end of Spen ORF (5’-GATTGTCATTGCCTCGGTG-3’) was cloned in the Cas9-PuroR pX459 vector (Addgene plasmid #62988). The donor template was made using a gblock from Integrated DNA Technologies coding for compatible 5’ and 3’ HA of 600 bp with a NheI and AscI restrictions sites in-between the 5’ and 3’ HA ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... of a virus driving expression of membrane-targeted mCherry under control of the GFAP promoter (AAV5/GFAP-hM3dq-mCherry, University of Zurich, Figs. 1-5 or AAV5/GfaABC1D-Lck-GFP, Addgene, Fig. 6) in the NAcore (+1.5mm AP ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AAAGTGGGACGCGGCACCTA-3’ from Zhang lab database) was cloned as synthetic dsDNA into lentiCRISPRv2 vector (provided by F. Zhang, Addgene plasmid #52961) as described (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... cloning to insert SOX9 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP plasmid (a gift from Janet Rossant, Addgene plasmid # 112851). AAVS1 repair template was created by Infusion cloning to swap the CAG promoter and Puromycin resistance cassette in plasmid AICSDP-42 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX2 knockout repair template was created by Infusion cloning to insert SOX2 5’ and 3’ homologous arms in EasyFusion T2A-H2B-GFP (a gift from Janet Rossant, Addgene plasmid # 112851). SFTPC targeting repair template was created by Infusion assembly of SFTPC 5’ and 3’ homologous arms together with T2A-Rox-EF1a-Rox-Venus-NLS ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2012), and followed by an eGFP-containing 5’ UTR (pGH112, Erik Jorgensen) in the destination vector pCFJ150 (Erik Jorgensen, Addgene plasmid #19329). The GCaMP6f-containing plasmid (Prig-3::GCaMP6f::unc-54 ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Cancer Biology 2020Quote: ... The HK2-targeting sequence 5’-CCGGCCAGAAGACATTAGAGCATCTCTCGAGAGATGCTCTAATGTCTTCTGGTTTTTT-3’ was cloned in the pLKO.1 hygro vector (a gift from Bob Weinberg; Addgene plasmid #24150). HK2 expression in Huh7-GCK+/HK2+ and Huh7-GCK+/HK2−Sh was analyzed on cell lysates by western blotting (Supplementary Fig ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... 5’- CGCGTCGACATGGTGAGCAAGGGCGAGGA-3’ and mCh REV: 5’-ACGCGGATCCCTTGTACAGCTCGTCCATGC-3’ and ligating it into pENTR4 no ccDB (gift from E. Campeau, Addgene plasmid #17424) plasmid (Campeau ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1ug of either SF3B1 sgRNA or Rosa26 sgRNA in pLKO.5 Puro-2A-GFP backbone was co-transfected with either 1ug of NG-ABE8e (Addgene plasmid 13849) or NG-ABEmax (Addgene plasmid 124163) ...
-
bioRxiv - Genomics 2024Quote: ... 5’CTTCG-AATAGAATCGCCGCCCGCT3’;antisense:3’CTTATCTTAGCGGCGGGCGACAAA5’)and(se nse:5’CTTC-GTTGTGGCTGCACAGACTGG3’;antisense:3’CAACACCGACGTGTCTGACC-CAAA5’) into the pU6-BbsI-chiRNA plasmid (Addgene no. 45946), following the protocol outlined on the flyCRISPR website ...
-
bioRxiv - Cancer Biology 2022Quote: ... and exon 5: AGCCCAAGGATGCCAGCCAG (guide 2) were ordered from IDT (Leuven, Belgium) and cloned into pSpCas9(BB)-2A-GFP(PX458) (Addgene Teddington, UK), according to the protocol of Ann Ran et al ...