Labshake search
Citations for Addgene :
651 - 700 of 1790 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... the PCR-amplified fragment of pie-1p::gfp::PH::pie-1 3’UTR was inserted into pCFJ1662 (a gift from Erik Jorgensen, Addgene #51482). Plasmid mixtures containing pCFJ1662_PH ...
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cell Biology 2023Quote: ... we used the SINAPs plasmid from the Singer lab (Addgene #84561)44 and a tdTomato-FL2 (containing the 3’UTR of FL2) plasmid previously cloned in-house using the tdTomato-C1 vector (Addgene #54653), a human FL2 clone in pANT7_cGST (DNASU ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transduced at an MOI < 0.3 with virus made via the pJR103 dual guide RNA plasmid (a kind gift from Marco Jost & Jonathan Weissman, Addgene #187242) (33) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGG GAG CAT TTG CGC TTG CGG C-3’ and 5’-AAA CGC CGC AAG CGC AAA TGC TCC C-3’ comprising the VPS35 guide RNA were annealed and inserted into the pLentiCRISPRv2 (Addgene, 49535) vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CAC CGT TCA TAC CTC AAG CGG ACA T-3’ and 5’-AAA CAT GTC CGC TTG AGG TAT GAA C-3’ comprising the VPS26 guide RNA were annealed and introduced into pLentiCRISPRv2 hygro (Addgene, 98291). Lentivirus was produced as described above and transduced into VPS35 KO cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... ABE-SpRY-OPT plasmid was created by inserting the 3’UTR+poly-A fragment in the pCMV-T7-SpRY-P2A-EGFP (RTW4830) (Addgene #139989) plasmid ...
-
bioRxiv - Cell Biology 2024Quote: Codon-optimized genes encoding His6-HTP-3 residues 2-739 and HIM-3 residues 1-291 were cloned as a polycistronic cassette into a single vector (UCB Macrolab 2B-T; Addgene #29666), resulting in an N-terminal His6-tag fused to HTP-3 (Kim et al ...
-
bioRxiv - Cell Biology 2024Quote: ... the miniIAA7 sequence was amplified using primers miniIAA-5-XbaI and miniIAA-3-XbaI as well as pSH-EFIRES-B-Serpin-miniIAA7-mEGFP plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129719) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... The complete ORF of AtAFB2 was amplified using primers AtAFB2-5-XbaI and AtAFB2-3-HindIII as well as pSH-EFIRES-P-AtAFB2 plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129715) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... for whole-body over-expression was constructed by cloning the ubiquitously-expressed eef-1A.1 (formerly eft-3) promotor into the plasmid pPD117.01 (A gift from Andrew Fire, Addgene plasmid #1587) for expression in C ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were transfected with pEGFP-LC3 (EGFP-LC3: microtubule associated protein 1 light chain 3 fused with enhanced green fluorescent protein) (Addgene, 24920) at 0.1 µg of the plasmid (in 50 µl Opti-MEM® Reduced Serum Media ...
-
bioRxiv - Developmental Biology 2024Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 μg) with packaging vectors including pMD2.G (3 μg, Addgene, # 12259), psPAX2 (6 μg ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... pENTR BRAF and pENTR BRAFV600E were gifts from Craig Ceol and pLenti CMV/TO Neo DEST (685-3) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17292). To generate pLenti CMV/TO NRASQ61R Neo we performed Gateway cloning to insert NRASQ61R from the donor vector pDONR223 NRASQ61R into the destination vector pLenti CMV/TO Neo Dest ...
-
bioRxiv - Cell Biology 2022Quote: ... sequence 5’-AGC GGC ATG AAG CAC TCA AT-3’ targeting the last coding exon of Fn1 was subcloned downstream the U6 promoter into the PX459 vector (Addgene, cat # 62988) encoding the Cas9-2A-Puromycin cassette (Ran et al. ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were grown in 10-cm dishes to 80% confluency before transfection with the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Developmental Biology 2021Quote: We grew HEK293T cells in 10-cm dishes to a confluence of 80% before we transfected the lentiviral vector (10 µg) with packaging vectors including pMD2.G (3 µg, Addgene plasmid # 12259), psPAX2 (6 µg ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Molecular Biology 2020Quote: ... we infected H9c2s with shRNA against RORα or scrambled shRNA for 48hrs then transfected with an EGFP-Cav-3 plasmid (Addgene plasmid #68396) or empty EGFP plasmid and an mRaspberry-Mito-7 plasmid (Addgene #55931 ...
-
bioRxiv - Cell Biology 2020Quote: ... targeting KIF4A sequence 5’-GCAAGATCCTGAAAGAGAT-3’ was generated using a multipurpose GATEWAY-based lentiviral tetracycline-regulated conditional RNAi system (GLTR) using pENTR-THT-III (Addgene plasmid #55791) and pGLTR-X-Puro (Addgene plasmid #58246 ...
-
bioRxiv - Neuroscience 2021Quote: ... Adjacent 2kb 5’ and 3’ homology regions were cloned into pHD-DsRed-attP (gift from Melissa Harrison & Kate O’Connor-Giles & Jill Wildonger, Addgene plasmid # 51019, RRID:Addgene_51019) 5’ region via EcoRI/NotI ...
-
bioRxiv - Genomics 2020Quote: ... the 3×Flag-BUD13-6HIS fragment was transferred into the pLJM1 lentiviral construct using the NdeI and EcoRI sites (Addgene plasmid # 19319). We produced lentiviruses via co-transfection of pCMV-d8.91 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and non-targeting sgRNA controls (SCR; supplementary table 3) flanked with BsmBI overhangs were ligated into the vector FgH1tUTG-GFP (Addgene Plasmid #70183) using 1uL BsmBI (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: miR-30a-chimeric hairpins for miR-329 and miR-495 stable overexpression were generated via polynucleotide cloning into the 3’ UTR of eGFP in pAAV-hSyn-EGFP vector (Addgene Plasmid #114213) using BsrGI and HindIII sites ...
-
bioRxiv - Developmental Biology 2022Quote: ... HEK293T cells at 70-80% confluency in 10 cm dishes were transfected with the insert construct plus 3rd generation packaging plasmids: pMD2.G (3 μg, Addgene plasmid #12259), psPAX2 (6 μg ...
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Developmental Biology 2023Quote: ... were transfected with 3 μg targeting vector pUC19-OCT4-T2A-NLS-EmGFP-P2A-Puro (kind gift from Timo Otonkoski; Addgene plasmid #89992) and 3 μg of PX459 plasmid (kind gift from Feng Zhang ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCS2-DCLK-mKO2 plasmid was constructed by amplifying the coding sequences of DCLK1a-202-deltaK (from pT2KXIG-Xef1a-DCLK-GFP, ZFIN ID: ZDB-TGCONSTRCT-090702-3) and mKO2 (from mKOkappa-2A-mTurquoise2, Addgene plasmid # 98837) using gene specific primers with overlapping arms DCLK1a-202_FOR (TGCAGGATCCCATATGGAGGAGCATTTTGACGA) ...
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Synthetic Biology 2023Quote: ... we designed a construct for the first tier of the dCas9-based cascade that is expressed from the EF1α promoter and contains a SapI-flanked cloning site in the 3’UTR for adding a gRNA to target a downstream target: “EF1a-Triplex-28-M13-28-pA” (Addgene ID 202041). Detailed protocols for modifying all of these constructs are provided on the Addgene website.
-
bioRxiv - Neuroscience 2024Quote: ... Gi DREADD virus (n=25,13 males, 12 females: AAV8-hSyn-DIO-hM4Di-mCherry,≥ 1×101 3 vg/mL, Addgene; Watertown, MA, USA) was mixed with GAD1-cre to express inhibitory designer receptors in VP GABA neurons ...
-
bioRxiv - Molecular Biology 2024Quote: ... WTC-11 iPSCs were electroporated with the corresponding homology plasmid (3 µg per electroporation) and two TALEN plasmids (0.75 µg per electroporation each) targeting the AAVS1 locus (Addgene, #52341 and #52342). iPSCs were dissociated into a single cell suspension ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 million HeLa cells were resuspended in 400 μL DMEM with 2 μg SpCas9 plasmid (Addgene, 71814), 500 ng gRNA plasmid ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Molecular Biology 2022Quote: ... Conditional knockout cells were generated by infection with media from a confluent 10 cm dish of 293T cells transfected with 3 µg pCL-Eco (Addgene, 12371 ref (17)) and 3 µg MSCV CreERT2 puro (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... containing 40bp of the 5’ end of cobK to a second 923-bp PCR-generated fragment (FR2) containing 107bp of the 3’ end of cobK in a three-way ligation reaction with p2NIL backbone (Addgene plasmid #20188; (46)) ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Genetics 2024Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722, originally from 29). Library1 ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.6-0.8 uL of a 1:1 mixture of GAD1-cre and mCherry virus (AAV8-hSyn-DIO-mCherry, ≥ 1×101 3 vg/mL; Addgene, Watertown, MA, USA) was injected bilaterally into VP ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Neuroscience 2024Quote: ... polyA_R, Table 3) and plasmid backbone (Col1E_F, Col1E_R, Table 4) were amplified from pPRISM-Stop-cmlc2-eGFP (Addgene kit #1000000154; Wierson et al., 2020). The PCR-amplified fragments were assembled using NEBuilder HiFi DNA Assembly Cloning Kit (E5520S ...
-
bioRxiv - Bioengineering 2024Quote: ... Double-cysteine substitution variants of DoubleCatcher were derived from pDEST14-SpyCatcher003-(GSG)3-SpyCatcher003-TEVs-SpyTag003DA by Gibson assembly: DoubleCatcher α-Lock (GenBank and Addgene deposition in progress), DoubleCatcher β-Lock (GenBank and Addgene deposition in progress) ...
-
bioRxiv - Bioengineering 2023Quote: Full length plasmid of PI3KCA (phosphatidylinositol-4,5-biphosphate 3-kinase catalytic subunit alpha, NM_006218.4) was purchased from Addgene (Plasmid ID: 81736, Hahn and Root Lab). The coding sequence of PI3KCA was cloned into Lenti-PCDH-EF1-mNeonGreen-MCS-T2A-puromycin plasmid (a kind gift from Fırat-Karalar Lab ...
-
bioRxiv - Cancer Biology 2024Quote: ... for 3 target sequences in the human TFE3 gene (GGCGATTCAACATTAACGACAGG, GCGACGCTCAACTTTGGAGAGGG, TCGCCTGCGACGCTCAACTTTGG) and cloned these into the lentiCRISPR v2 vector (Addgene #52961, Watertown, MA, USA). Lentivirus was produced as previously described 1 and HK-2/SFPQ-TFE3 cells were infected for 48 h ...