Labshake search
Citations for Addgene :
501 - 550 of 1790 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were transduced with PL-SIN-EOS-C(3+)-EiP (a gift from James Ellis; Addgene #21313) and selected with 1 µg/mL of puromycin (Millipore ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041; http://n2t.net/addgene:55041; RRID:Addgene_55041) constructs (Olenych et al ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Mito-7 and mCherry-ER-3 were kindly provided by Michael Davidson (Addgene plasmids #55102 and #55041).
-
bioRxiv - Cell Biology 2020Quote: ... a fragment containing the 3×Flag-nls-cas9-nls coding sequence isolated from pBS-Hsp70-cas9 (Addgene, #46294) with same enzymes was inserted ...
-
bioRxiv - Genetics 2021Quote: ... sgRNAs (single gRNA) expressing plasmid was generated using the pCFD3-dU6:3 gRNA vector (Plasmid ID: #49410, Addgene) as described in (Port et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042; http://n2t.net/addgene:85042; RRID:Addgene_85042) and GFP-TM(SAC1 ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2021Quote: ... (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341; RRID:Addgene_20341] ...
-
bioRxiv - Cell Biology 2020Quote: ... and ESRG (6 μg each) along with 3 μg of pMD2.G (gift from Dr. D. Trono; RRID:Addgene_12259) was transfected into PLAT-GP packaging cells ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... Injection mixes were prepared in MilliQ H2O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a 3’ untranslated region and terminator sequence (3UTR) from Agrobacterium tumefaciens octopine synthase (AtuOCS) (pICH41432, Addgene #50343). A calibrator construct (pEPYC1CB0197 ...
-
bioRxiv - Immunology 2021Quote: ... an envelope deficient HIV-1 dual reporter construct that was cloned by recombination of the pNL.luc.R-E-plasmid (NIH AIDS Reagent Program) and the fully infectious pNL4-3 mCherry luciferase plasmid (Addgene) [24 ...
-
bioRxiv - Cell Biology 2020Quote: ... pDD162 (Peft-3::Cas9 + Empty sgRNA) was a gift from Bob Goldstein (Addgene plasmid # 47549; http://n2t.net/addgene:47549; RRID:Addgene_47549) (Dickinson et al. ...
-
bioRxiv - Cell Biology 2021Quote: tdTomato-ER-3 and LAMP1-Clover (Clover-Lysosomes-20) were gifts from Michael Davidson (Addgene #58097 and #56528). Mito-PhiYFP (pPhi-Yellow-mito ...
-
bioRxiv - Cancer Biology 2023Quote: ... The standard transfection mixture included 3 μg of total DNA [1.5 µg lentiviral plasmid + 1.5 µg helper plasmids - psPAX2 (RRID: Addgene_12260) and pMD2.G (RRID ...
-
bioRxiv - Developmental Biology 2023Quote: ... The full-length RUVBL1 with N-terminal 3×FLAG tag (pCDNA-3xFLAG-Pontin) was obtained from Addgene (51635). All cell lines were grown in DMEM (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmid encoding the sequence of the cleavage site for Caspase 3 (DEVD) and FLIP-GFP reporter (Addgene# 124428) was digested using the NheI_HF and XmaI (New England Biolabs ...
-
bioRxiv - Genetics 2024Quote: ... using 3 µg of pCAG-NLS-HA-Bxb1 plasmid (a kind gift from Pawel Pelczar (Addgene plasmid #51271) (Hermann et al ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... pKB12 was constructed by replacing the LEU2 auxotrophic cassette of pDEST-DHFR F[3]-C (LEU2) (Addgene #177796) (Marchant et al ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-mDlx-ChR2-mCherry-Fishell-3 was a gift from Gordon Fishell (Addgene plasmid # 83898; http://n2t.net/addgene:83898; RRID:Addgene_83898) 51 to express ArchT 67 fused to TS-EYFP-ER sequence that was cloned from a pcDNA3.1 CMV-ChRmine-TS-EYFP-ER plasmid gift of the Hegemann laboratory at the Humboldt Universität ...
-
bioRxiv - Molecular Biology 2024Quote: ... CASFx-1 (RBFOX1N-dCasRx-C) and CASFx-3 (dCasRx-RBM38) were obtained from Addgene (Plasmid #118635 and #118638). RBFOX1N-dPspCas13b-C was constructed previously 13 ...
-
bioRxiv - Genomics 2023Quote: ... All 3 of the 6 wells were transfected with 100 ng of pCAG-NLS-HA-Bxb1 (Addgene #51271) and 1,500 ng of donor attB library whereas the T25 was transfected with 1,000 ng of the Bxb1 containing plasmid and 5,000 ng attB library ...
-
bioRxiv - Biochemistry 2023Quote: The construct for E.coli expression of WT caspase-3 (pET23b-Casp3-His) was obtained from Addgene (plasmid 11821). The construct for mammalian expression of caspase-3/GFP was a gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... The lin-3 guide sequence was inserted into pDD162 (eef-1A.1p::Cas9 + empty sgRNA, Addgene plasmid #47549) using Q5 site-directed mutagenesis (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... pCfB2904(XI-3 MarkerFree) was a gift from Irina Borodina (Addgene plasmid # 73276; http://n2t.net/addgene:73276 ; RRID:Addgene_73276) General yeast manipulation ...
-
bioRxiv - Neuroscience 2024Quote: ... an oligonucleotide pair (Supplemental Table 3) was annealed and cloned into BbsI-digested pCFD3-dU6-3gRNA (Addgene #49410) as described (Port et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... groups of 3-4 pups were separated from their mother and 6 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV2/5-CMV-EGFP (250 nl, Addgene 105530, 2 × 1013 GC / ml), and which has since been published7.
-
bioRxiv - Cell Biology 2020Quote: ... Injection mixes were prepared in MilliQ H O and contained 50 ng/ml Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two guide RNAs (cgttcatatcctcgcgagta and cagccgagaccacgactacc) designed to target exon 3 (14-bp apart) were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: pUltra-U6-crRNAs-U6-tracr was constructed in a 3-part Gibson assembly using PacI linearized pUltra (Addgene #24129)54 backbone ...
-
bioRxiv - Neuroscience 2020Quote: ... bilaterally injected using a pulled glass needle in the hippocampal area with 0.5 μL AAV-hSyn-Cre-EGFP at 3 × 1012 GC ml-1 (Addgene #105540 ...
-
bioRxiv - Bioengineering 2021Quote: ... rat TE-NSPs were incubated overnight at 5 DIV with media including 1/2000 of pAAV1.hSyn.eGFP.WPRE.bHG (final titer of ~3×1010 genomic copies/mL; Addgene, 105539-AAV1), with a full media change on the next day.
-
bioRxiv - Neuroscience 2021Quote: ... a 1:3 mixture of AAV1-CAG-mRuby3 (custom made from plasmid Addgene 107744, titer: 1.6×1012 vg/ml) and AAV1-Syn (or CAG)-FLEX-GCaMP6s (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PTEN or non-targeting-control (see Table 3) were cloned into pLKV2-U6gRNA5(BbsI)-PGKpuro2ABFP-W (Addgene ID:67974) and Cas9 expressing cell lines were transduced and selected with puromycin (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... by PCR and products were cloned into NheI and EcoRV restriction sites (Table 3: marked with blue) of pcDNA3.1-hygro vector (Addgene, kindly provided by Mark Richards-Bayliss group ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 dual reporter vector expressing mCherry and luciferase (NL4-3 mCherry Luciferase, plasmid#44965) was purchased from Addgene. Plasmid expression a C-terminally truncated SARS-CoV-2 S protein (pSARS-CoV-2Δ19 ...
-
bioRxiv - Genomics 2021Quote: ... we performed 80 co-transfections of HeK293T virus packaging cells (at approximatelly 60-70% confluence on 10 cm dishes) with 3 μg of the pDECKO_mCherry plasmid library and 2.25 μg of the packaging plasmid pVsVg (Addgene 8484) and 750 ng of psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... a lenti-viral backbone containing a UCOE-EF-1α promoter and a 3’ WPRE element was used (Addgene #135448), which was a kind gift of Martin Kampmann and Jonathan Weissman ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and Flailer primary neuronal cultures were infected at 3 DIV with AAV coding for GCaMP6s (Addgene #51086) and FL1 or control AAVs ...
-
bioRxiv - Genomics 2023Quote: ... Both gRNA (1 µg each) vectors were co-transfected with 3 µg of pCas9_GFP (a gift from Kiran Musunuru; Addgene plasmid #44719 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4T1 and EMT6.5 cancer cells were transfected with the mammalian expression lentiviral vector pLKO.3 Thy1.1 (Addgene plasmid #14749) containing the surface protein Thy1.1 as a reporter protein ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...