Labshake search
Citations for Addgene :
601 - 650 of 2209 citations for Puumala Virus Glycoprotein 2 Gc Human Heterodimeric Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5HT and NPY interneurons in the ACC 200 nl of virus (pAAV-hSyn-DIO-mCherry, Addgene 50459) was injected into the ACC ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2023Quote: We injected a conditional GCaMP expressing AAV virus (AAV9:FLEX:GCaMP6s; Addgene Plasmid #:100845; Chen, et al., 2013) in the AOB (Bregma 3.5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
bioRxiv - Cancer Biology 2019Quote: ... lentiviral vector to tag the nucleus of HFF1 cells was purchased from Addgene (Plasmid #21210). Trypsin/EDTA was purchased from Thermo Fisher Scientific (R001100) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first eliminated the HA-tag in phage-UBC-NLS-HA-tdMCP-HaloTag (Addgene, 104098) and inserted IRES-tdPCP-SNAPtag-CAAX downstream of the tdMCP-HaloTag ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Genomics 2024Quote: ... GL261 cultures were partially transduced with sgRNA expression lentiviruses with a GFP tag (Addgene 187241)40 ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Neuroscience 2020Quote: ... two viruses were injected in the same animal: AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Addgene; 1 × 1013 GC/mL titer, 294.4 nL) in Cg1/M2 ...
-
bioRxiv - Neuroscience 2020Quote: The GECI AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with the Cre recombinase AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Neuroscience 2022Quote: ... an enhanced green fluorescent protein (eGFP) under the CaMKIIα promoter was used (AAV9-CaMKIIα-eGFP-WPRE; Addgene #50469, 2.4E+13 GC/mL). We infused the AAV in the dorsal hippocampus through the following coordinates relative to bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Neuroscience 2021Quote: ... 450nl of a mostly anterograde virus containing the Cre recombinase under CamKII promoter to target pyramidal cells (AAV1_CamKII_Cre_SV40, Addgene, USA) was injected into the right MEC (+3.2mm laterally from Lambda along the lambdoid suture and DV -2.5mm from skull level) ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194; http://n2t.net/addgene:125194; RRID:Addgene_125194)40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Immunology 2019Quote: Hem1 expression constructs containing C-terminal 3xFLAG-v5 tags were generated in a pcDNA3.1 backbone (Addgene) using Gateway cloning technology (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Snrpb and Snrpd2 cDNA were cloned into a modified pCS2+8NmCherry vector lacking mCherry tag (Addgene) for their in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length ORF24 with a C-terminal Strep tag (pcDNA4/TO-ORF24-2xStrep) (Addgene plasmid #129742) was previously described (13) ...
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238 ...
-
bioRxiv - Cell Biology 2023Quote: ... The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600 ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression vectors encoding either no tag (UC Berkeley Macrolab vector 2A-T, Addgene ID 29665) or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Neuroscience 2023Quote: ... An HA-tag was inserted after position G29 (referring to the numbering of Addgene Plasmid #49333) and flanked by short ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of AAV5-Syn-GCaMP6f-WPRE-SV40 (titre 2.8 × 1013 GC/ml; gift from Douglas Kim & GENIE Project; Addgene viral preparation #100837-AAV5)62 was injected using a microinjection pump (Nanoliter 2010 ...
-
bioRxiv - Neuroscience 2022Quote: ... Dual opsin-assisted circuit mapping and opto-tagging in brain slices: AAV2/-Syn-ChrimsonR-tdT (Addgene plasmid 59171, 1.3×1013 GC ml-1); AAV2/1-CAG-Flex-FlpO (made in house ...
-
bioRxiv - Neuroscience 2024Quote: ... The viral vectors containing the Cre-dependent plasmid pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AddGene #44362-AAV8; titer of 2.1×1013 GC/mL), Cre-dependent control plasmid pAAV-hSyn-DIO-mCherry (AddGene #50459-AAV8 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...