Labshake search
Citations for Addgene :
601 - 650 of 2707 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of VSV-G envelope expressing plasmid pMD2.G (Addgene #12259) were co-transfected into HEK293T cells using calcium phosphate transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng purified oligo were mixed with 5 μg lentiCRISPR v2 (Addgene #52961) backbone ...
-
Structures of native SV2A reveal the binding mode for tetanus neurotoxin and anti-epileptic racetamsbioRxiv - Biochemistry 2024Quote: ... Nb1-5 were PCR amplified and subcloned into the vector pBXNPHM365 (Addgene #11099) and fused with a C-terminal (TSII-tagged ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg/ml of pT3-EF1a MYC DNA (92046, Addgene, Watertown, MA, USA), and 0.5 µg/ml pCMV HSB2 sleeping beauty transponase was prepared in a sterile 0.9% sodium chloride (NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Neuroscience 2020Quote: [2] QF2-Hsp70 from pattB-synaptobrevin-7-QFBDAD-hsp70 (Addgene plasmid #46115) (Primers ...
-
bioRxiv - Neuroscience 2020Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supplemented with 2 ng/μl RNase-free plasmid DNA (pX330, Addgene #42230) in a 15 ml Falcon tube ...
-
bioRxiv - Molecular Biology 2020Quote: 2 μl RNase-free plasmid DNA (pX330, Addgene #42230, 100 ng/μl),
-
bioRxiv - Bioengineering 2021Quote: We cloned the TRS-Leader-SARS-CoV-2-d2eGFP plasmid (Addgene 171585) by introducing 75 nt of the SARS-CoV-2 Leader sequence into the NheI-digested EFS-EGFPd2PEST-2A-Hygro plasmid (Addgene 138152) ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Neuroscience 2021Quote: The pCMV4-FLAG-UBQLN2 plasmid (p4455 FLAG-hPLIC-2; Addgene plasmid # 8661) and pCS2-FLAG-UBQLN1 plasmid (p4458 FLAG-hPLIC-1 ...
-
bioRxiv - Systems Biology 2021Quote: ... Ago2_KO1 mESCs were transfected with pX458-sgRNA_Ago1_1/2 (Addgene #73533 and #73534), and pX458-sgRNA_Ago1_3/4 (Addgene #73535 and #73536 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 spike gene or VSV-G (pMD2.G (Addgene #12259)) using VigoFect (Vigorous Biotechnology) ...
-
bioRxiv - Genetics 2021Quote: ... pLVX-EF1alpha-SARS-CoV-2-orf8-2xStrep-IRES-Puro (Addgene plasmid #141390). Orf8 deletion constructs were produced on the Orf8 backbone using Pfu Turbo HotStart DNA polymerase (Agilent 600322-51 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... β-arrestin 2 was amplifying from pCDNA3.1(+)-CMV-bArrestin2-TEV (Addgene #107245) with Gibson Assembly primers compatible with the NEBuilder HiFi DNA Assembly Kit (New England BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: ... (2) sfGFP was amplified from template pHD-sfGFP Scareless dsRed (Addgene 80811) and (3 ...
-
bioRxiv - Neuroscience 2021Quote: ... hSS were labeled with AAV-DJ-mDlx-GCaMP6f-Fishell-2 (Addgene, 83899) and placed in a well of a Corning 96-well microplate (Corning ...
-
bioRxiv - Neuroscience 2020Quote: ... (2) AAV1-hSYN-β-Arrestin2-TEV-C-P2A-TdTomato (Addgene Cat #: 89873), (3 ...
-
bioRxiv - Genetics 2020Quote: ... HUDEP-2 cells with stable expression of LentiCas9-Blast (Addgene plasmid 52962) were transduced at a low multiplicity of infection (MOI ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg of pSpCas9(BB)-2A-Puro-NASP-sgRNA_V2.0 (#62988, Addgene) using Lipofectamine 3000 (L3000001 ...
-
bioRxiv - Molecular Biology 2021Quote: pLVX-EF1alpha-SARS-CoV-2-Nsp1-2XStrep-IRES-Puro plasmid (Addgene, 141367) and pLVX-EF1alpha-SARS-CoV-2-Nsp2-2XStrep-IRES-Puro plasmid (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: Adeno-associated virus (AAV) type 2 carrying cre-dependent ChR2-eYFP (Addgene plasmid 20298 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV8-hSynapsin1-hM3D(Gq)-mCherry (Addgene, #50474, ≥ 2 x 1012 vg/ml) or AAV9-hSynapsin1-Lamp1-mScarlet-I (3.06 x1012 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... pBS-KS-attB2-SA(2)-T2A-LexA::QFAD-Hsp70 (Addgene plasmid #62949) and pC-(lox2-attB2-SA-T2A-Gal4-Hsp70)3 (Addgene #62957 ...
-
bioRxiv - Microbiology 2023Quote: A plasmid encoding the SARS-CoV-2 Spike was obtained from Addgene #145032 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV-mDlx-GCaMP6f-Fishell-2 was a gift from Gordon Fishell (Addgene plasmid # 83899-AAV1 ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 53BP1-mCherry was excised mCherry-BP1-2 pLPC-Puro (Addgene plasmid #19835) (Dimitrova et al ...
-
bioRxiv - Synthetic Biology 2023Quote: The promoters from the genes alcohol dehydrogenase 2 (ADH2, Addgene ID 195015), xylose reductase (XYL1 ...
-
bioRxiv - Cell Biology 2023Quote: ... pRC/CMV::DVL-2-Myc was obtained from Addgene (Cambridge, Massachusetts, USA) (plasmid #42194 ...