Labshake search
Citations for Addgene :
451 - 500 of 2707 citations for 5 Azepane 1 sulfonyl 2 methoxy benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Neuroscience 2022Quote: ... mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Bioengineering 2022Quote: ... the modules in these plasmids (split Cas9, MCP, sgRNA cassette) were PCR-amplified and recloned into 2 lentiviral plasmids (pLKO.1 neo, Addgene #13425; pLJM-EGFP, Addgene #19319) and ...
-
bioRxiv - Neuroscience 2023Quote: 750 nl of rAAV.EF1a.DIO.hChR2(H134R).eYFP or rAAV.EF1a.DIO.eYFP (3-4 x 10^12 vg/ml, AAV5, University of North Carolina Vector Core; 1-2 x 10^13 vg/ml, AAV1, Addgene, 27056-AAV1 and 20298-AAV1) were injected into each hemisphere of the VTA of 3–4-month-old DAT-Cre mice ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of N gene with the natural codon usage of SARS-CoV-2 from pSARS-CoV-2 (N) plasmid (Addgene #153201) was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 using the same enzymes.
-
bioRxiv - Cell Biology 2024Quote: ... Dynamin-2-EGFP was generated in this study by exchanging Dynamin-2 from Dyn2-pmCherry N1 (purchased from Addgene mentioned above) with EGFP from pEGFP-N1 using EcoRI and NheI restriction digestion-based cloning.
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2021Quote: Stock of lentiviral particles were obtained by transfection of HEK293T cells (2×106 cells) with 2 μg of lentivector plasmid lentiCRISPRv2 (a gift from Feng Zhang, Addgene plasmid, 52961) expressing single guide RNA targeting an exon within ATG5 gene ...
-
bioRxiv - Immunology 2020Quote: ... pTwist EF1 Alpha-SARS-Cov-2-S-2xStrep plasmid encoding for the SARS-CoV-2 Spike protein was a gift from Nevan Krogan (Addgene plasmid #141382). pcDNA3-sACE2(WT)-Fc(IgG1 ...
-
bioRxiv - Neuroscience 2023Quote: ... were secured in a stereotaxic frame and unilateral or bilateral injections of fluorogold or choleratoxin B subunit tracers dissolved in glycerol (FG 2% iontophoresis by 2 µA pulses with 2/2 s on/off duty cycle for 5 minutes and CTB 0.5% iontophoresis by 5 µA pulses with 2/2 s on/off duty cycle for 7-10 minutes) or retrograde pAAVrg-CAG-GFP (Addgene: 37825-AAVrg) or retrograde AAVrg-EF1a-mCherry-IRES-Flpo (Addgene ...
-
Safe plant Hsp90 adjuvants elicit an effective immune response against SARS-CoV2 derived RBD antigenbioRxiv - Molecular Biology 2023Quote: ... pseudo-type lentiviruses coated with the SARS-CoV-2 S protein harboring the vector pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian (Addgene plasmid #145780) were prepared by co-transfecting HEK293T cells with psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Bioengineering 2022Quote: ... we generated 2 sgRNA plasmids each harboring 2 distinct sgRNAs targeting the promoter regions of eve (AAEL007369, OA-1053A, Addgene plasmid #184006) and hh (AAEL006708 ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP-C1(2)δ (Tobias Meyer, Addgene plasmid #21216), GFP-nes-2xPABP (Sergio Grinstein ...
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19, Addgene) at a ratio of 1:2:1 using the transfection reagent (Lipofectamine 3000 ...
-
bioRxiv - Immunology 2021Quote: ... 2) luciferase reporter plasmid pLenti-CMV Puro-Luc (Addgene), and 3 ...
-
bioRxiv - Bioengineering 2021Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Biochemistry 2020Quote: ... overnight cultures of Rosetta 2 (DE3)/pMSP1D1 (Addgene #20061) were diluted 1:100 in LB (Difco ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 2.5 ng/µl Pmyo-2::mCherry (Addgene #19327). Three injected animals were pooled and incubated for 3 days at 20 °C before adding 250 ng/µl of hygromycin per plate ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) chloramphenicol resistance cassette from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pMDG.2 (a gift from Didier Trono, Addgene #12559) and the lentiviral expression construct ...
-
bioRxiv - Genetics 2020Quote: ... and 2 µg of pMD2.G (Addgene, Cat# 12259)—using Lipofectamine (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... (2) araC and PBAD from pTARA[52] (Addgene #39491), (3 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 μg of pCMV6M-Pak1-WT (Addgene, 12209), pCMV6M-Pak1-T423E (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 2) AAV1.CAG.tdTomato (5.06×1012 GC/kg; Addgene #59462), 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-ef1a-fDIO-EYFP (Addgene 55641, titer 2×1011), AAVDJ-Ef1a-mCherry-IRES-cre (Addgene 55632 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMDG.2 (VSV-G expressor) and lentiCRISPRv2 (Addgene #52961) for generation of bulk PD-L2-KO cells or luciferase (Addgene #105621 ...
-
bioRxiv - Microbiology 2022Quote: ... individual proteins were cloned into vector 2-BT (Addgene #29666 ...
-
bioRxiv - Synthetic Biology 2022Quote: pcDNA3-SARS-CoV-2-S-RBD-sfGFP (Addgene #141184) and pcDNA3-R4-uAb (Addgene #101800 ...
-
bioRxiv - Pathology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (Addgene #141382)28 was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μg of pMtnA FLAG-IntS6 puro (Addgene #195076) or pMtnA FLAG-IntS12 puro (Addgene #195077 ...
-
bioRxiv - Cell Biology 2024Quote: ... the pMD2.G packaging plasmid (2 µg, Addgene, #12259), and 3X polyethylenimine was added dropwise to the culture and incubated for 18 hours at 37 °C ...
-
bioRxiv - Molecular Biology 2024Quote: Sequence encoding SARS-CoV-2 S protein (Addgene #164433) was a gift from Alejandro Balazs ...
-
bioRxiv - Microbiology 2024Quote: SARS-CoV-2 expression plasmids were acquired from Addgene, courtesy of the contribution from Dr ...
-
bioRxiv - Cell Biology 2024Quote: ... BCL2L13(Y213A/I216A/W276A/I279A)-GFP (ΔLIR1+2) (RRID:Addgene_223782), BCL2L13(I224A/L227A/W276A/I279A)-GFP (ΔLIR1+3 ...
-
bioRxiv - Cell Biology 2024Quote: ... a mixture of 2 μg pMD2.G (Addgene #12259), 8 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and