Labshake search
Citations for Addgene :
551 - 600 of 2785 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade B BH10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... into the AC and a retrograde Cre virus: pENN/AAVrg-hSyn-Cre-WPRE-hGH (1.8E+13 vg/ml, 200nl, Addgene catalog #105553) into the pStr ...
-
bioRxiv - Neuroscience 2023Quote: ... We bilaterally injected Cre-dependent DREADD virus (Roth, 2016): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (2.4E+13 vg/ml, 350nl, Addgene catalog # 44362) or AAV5-hSyn-DIO-mCherry (2.6E+13 vg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... We expressed the soma-targeted opsin ST-ChrimsonR 43 in excitatory neurons by injecting a virus (1012 titer; AAV2/2 camKII-KV2.1-ChrimsonR-FusionRed; Addgene, plasmid #102771) into the craniotomy ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 μL of the viral cocktail AAV5-CamKIIa-C1V1(E122T/E162T)-TS-eYFP-WPRE-hGH (2.5 × 1012 virus molecules/mL; Penn Vector Core, University of Pennsylvania, PA, USA, Addgene number: 35499) was administered across four sites into the primary somatosensory (S1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... B7GG cells were transfected by Lipofectamine 3000 (Thermo Fischer) with rabies virus genomic vectors RabV CVS-N2cΔG-eGFP (Addgene plasmid #73461) or SAD-B19ΔG-eGFP (modified from Addgene plasmid # 32634) ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Neuroscience 2021Quote: Heterologous expression of human NaV1.2 WT (Addgene #162279)(DeKeyser et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Microbiology 2021Quote: The Tobacco mosaic virus (TMV) expression vector pJL-TRBO has been previously described [57] and was a gift from John Lindbo (Addgene plasmid # 80082). The TMV vector containing p26:GFP has also been previously described [41] ...
-
bioRxiv - Immunology 2019Quote: ... We used the resulting virus particles to transduce immortalized wild-type C57BL/6 cells that express doxycycline-inducible SpCas9 enzyme (generated using Addgene plasmid #50661). We cultured transduced cells in 3.0 μg/ml blasticidin (Invivogen ...
-
bioRxiv - Genomics 2022Quote: ... BPTF BD with an N-terminal 6xHistidine (6His) tag and Tobacco Etch Virus (TEV) Protease cleavage site was from Addgene (plasmid 39111). This was modified using the Q5 Site-directed mutagenesis kit (New England Biolabs [NEB] ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Cell Biology 2019Quote: ... Tetracycline-inducible MYH12A WT and S1AS2A-mutant IA32 cell lines were made by first preparing a stable rtTA-expressing IA32 cells using pLenti-CMV-rtTA3-hygro lentivirus infection (virus made with Addgene plasmid 26730) and selection with 100 μg/mL hygromycin ...
-
bioRxiv - Bioengineering 2019Quote: ... H9 GFP hESC line was generated by infecting H9 hESCs with pLenti PGK GFP Puro virus generated from the plasmid purchased from AddGene (Cat#: 19070)(Campeau et al. ...
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Neuroscience 2021Quote: The CVS N2cdG-H2B-EGFP rabies virus was generated by replacing GFP in the rabies genomic plasmid RabV CVS-N2c(deltaG)-EGFP (Addgene, Plasmid #73461) with H2B-EGFP flanked by 5’ XmaI and 3’ NheI-KasI sites ...
-
bioRxiv - Neuroscience 2021Quote: The SAD B19dG-H2B-EGFP virus was generated by inserting the H2B-EGFP sequence into the gG locus of the pSADdeltaG-F3 plasmid (Addgene, Plasmid #32634). The EnvA SAD B19dG-H2B-EGFP rabies viruses were generated from the genomic plasmid as described previously2 ...
-
bioRxiv - Neuroscience 2020Quote: ... Non-Cre-dependent expression of hM4D(Gi) was mediated by administration of an AAV8-CaMKIIa-hM4D(Gi)-mCherry virus (Addgene; plasmid #50477) while that of a GFP reporter by administration of an AAV5-CaMKII-GFP virus (Boyden ...
-
bioRxiv - Immunology 2022Quote: ... the cells were transduced with virus produced using the lentiCas9-EGFP plasmid (a gift from Phil Sharp & Feng Zhang, Addgene plasmid # 63592), single-cell sorted using a Sony SH800 cell sorter ...
-
bioRxiv - Cell Biology 2022Quote: Rac1 activation was achieved by expressing PA-Rac1 via retro-virus infection using pBabe-TetCMV-puro-mCherry-PA-Rac1 (Addgene Plasmid #22035) in MV3 cells ...
-
bioRxiv - Immunology 2022Quote: ... Virus was generated by transfecting the sgRNA plasmid constructs into HEK 293T cells with the psPAX2 packaging (Didier Trono, Addgene plasmid #12260) and pCMV-VSVG envelope (Bob Weinberg ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned into either a Lentiviral CMV-driven construct for use in cell culture experiments (shown in Figure S2) or a GFAP-GFP Adeno-associated virus (AAV) construct (Addgene plasmid #50473) for use in animal experiments (utilized in Figure 3 and Figure 4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or pLenti-PGK-tdTomato-Akaluc (TdT-AkaLuc) virus (subcloned from pLenti-PGK-Venus-Akaluc(neo)) and HR180-LGR5-iCT plasmids through Gibson assembly (Addgene 124701; 129094). For cecal injections ...
-
bioRxiv - Neuroscience 2023Quote: ... Two small holes were made in the skull above the injection sites and 200nl (100nl/min) of AAV8-hSyn-DIO-mCherry or AAV8- hSyn-DIO-hm4Di-mCherry virus (Addgene, Watertown, MA) was infused in both hemispheres of the PVN using a 1µL Hamilton syringe (0° angle ...
-
bioRxiv - Neuroscience 2023Quote: ... For DREADD experiments 6-7 week old mice were injected bilaterally with the inhibitory virus AAV-hSyn-hM4D(Gi)-mCherry (AddGene, 50475-AAV2) or control virus AAV-hSyn-EYFP (AddGene ...
-
bioRxiv - Neuroscience 2024Quote: ... commenced with stereotaxic surgery to infuse a pAAV1 CD68-hM4D(Gi)-mCherry virus (Addgene viral prep #75033-AAV1 from Bryan Roth, Addgene, Watertown, MA) into the LC ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV8-hSyn-DIO-hM4D(Gi)-mCherry (gift from B. Roth; Addgene viral prep # 44362-AAV8), pAAV8-hSyn-DIO-hM3D(Gq)-mCherry (gift from B ...
-
bioRxiv - Neuroscience 2021Quote: ... pAAV8-hSyn-DIO-hM3D(Gq)-mCherry (gift from B. Roth; Addgene viral prep 44361-AAV8), AAV8-Ef1a-DIO-mCherry (gift from B ...
-
bioRxiv - Cancer Biology 2021Quote: PDXO cells were transduced with pHIV-Luc-ZsGreen (a gift from B. Welm; Addgene# 39196), pLKO.1-Scr-TD or pLKO.1-Cys-TD as previously described (Tavora et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... The original CIRTs-6: B-defensin 3-TBP6.7-YTHDF2 plasmid (# 132544) was purchased from Addgene and the YTHDF2 domain was PCR amplified and cloned into the AgeI and NheI sites ...
-
bioRxiv - Molecular Biology 2023Quote: ... The type I-B Anabaena variabilis ATCC 29413 CAST was sub-cloned from Addgene (#168137) [16] ...
-
bioRxiv - Microbiology 2023Quote: ... this plasmid was used in a Golden Gate reaction using pMB1-B (Addgene number 190115) and BsaI-HF (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...