Labshake search
Citations for Addgene :
801 - 850 of 2785 citations for Human Immunodeficiency Virus Tat Protein HIV 1 Clade B BH10 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T target cells transfected with 500ng of a human ACE2 expression plasmid (Addgene) were seeded at 2×104 in 100μL DMEM-10% in a white-bottomed 96-well plate (Corning ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: The gRNA library targeting >1500 human miRNA loci was obtained from Addgene (32). MutuI cells were transduced with lentiparticles derived from the doxycycline inducible Cas9 vector pCW-Cas9 (Addgene Plasmid #50661 ...
-
bioRxiv - Neuroscience 2024Quote: ... and Cdk5rap2 from mouse and human were cloned into FUGW (Addgene plasmid # 14883) [52] ...
-
bioRxiv - Biochemistry 2024Quote: An expression plasmid of human GST-Cdk2 was purchased from AddGene (plasmid #61845) and used without further subcloning ...
-
bioRxiv - Biophysics 2024Quote: The coding sequence of human fascin1 (GeneBank, NM_003088.4) was obtained from Addgene (#31207) and subsequently inserted into a pGEX-6p-1 vector (Cytiva ...
-
bioRxiv - Immunology 2021Quote: The SARS-CoV-2 pseudoviral particles expressing COVID-19 spike protein pGBW m4137384: S protein was purchased from Addgene (149543) and the virus particles were produced as describe previously (Hoffmann et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for mitochondria specific protein/ autophagosome specific protein is transfected in HEK293T cells along with packaging vector (pDR8.2; Addgene #8455) and envelope encoding protein (VSVG ...
-
bioRxiv - Systems Biology 2021Quote: ... and envelope protein pCMV-VSV-G (Addgene #8454) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and pBAD expressing fluorescent protein variants (Addgene, UK). Primers used in the assembly of the vectors are listed in SI Table 1.
-
bioRxiv - Biophysics 2022Quote: Fluorescent proteins were obtained from Addgene (https://www.addgene.org/) transfected using 0.2 ug plasmid DNA ...
-
bioRxiv - Physiology 2022Quote: ... EGFP-DCTN1 fusion protein (Addgene pEGFP-p150Glued, #36154) or tdTomato-EB3 fusion protein (Addgene ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Neuroscience 2019Quote: ... and VSV-G envelope generated by inserting human Sirt3 plasmid (Purchased from Addgene #13814) into HIV.SIN.cPPT.CMV.eGFP.WPRE (Purchased from U Penn Vector Core ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...