Labshake search
Citations for Addgene :
551 - 600 of 3199 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 0.3 μl of AAV2/9-CAG-ChR2-mCherry (3 × 1012 genomic copies per mL, Addgene, 100054) or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL ...
-
bioRxiv - Synthetic Biology 2023Quote: ... An all-in-one Cas9/gRNA expression construct by cloning an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene #129727) downstream of the hU6 promoter in a PX458 (Addgene #48138 ...
-
bioRxiv - Bioengineering 2024Quote: An all-in-one Cas9/gRNA expression construct encoding an AAVS1 sgRNA sequence derived from pCas9-sgAAVS1-2 PX458 (Addgene; 129727) was placed downstream of the hU6 promoter in a PX458 (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... DICE system was introduced into the H11 locus of NKX2-5eGFP/w using 2 plasmids: one carrying Cas9 nuclease and two guide RNAs (Addgene#164850) and a second one carrying a landing pad (Addgene #51546 ...
-
bioRxiv - Biophysics 2024Quote: ... in combination with pBV-Luc BDS-2 3x WT (pBDS-2) (BDS-2 3x WT (p53 binding site) was a gift from Bert Vogelstein (Addgene plasmid #16515 ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were stereotaxically injected under isoflurane anesthesia (1% v/v in oxygen, 1 L/min) with 250 nL of AAV8-hSyn-DIO-hM3d(Gq)-mCherry (Addgene, Catalog # 44361-AAV8) at a rate of 50 nL/min using a 1000 nL Hamilton syringe bilaterally in the dorsal striatum (coordinates ...
-
bioRxiv - Neuroscience 2024Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng μl−1) and pBS130 (400 ng μl−1) (encoding PhiC31 integrase under control of a heat shock promoter (Addgene #26290, Ref.80)) ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2024Quote: The shRNA construct for mouse aldolase A was generated using oligos directed towards the 3’UTR of Aldoa (GCCCACTGCCAATAAACAACT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) and cloned into the pLKO.1 cloning vector (Addgene Cat# 10878, RRID:Addgene_10878) and pCGLH vector for lentivirus and in utero electroporation experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
Cellular sialoglycans are differentially required for endosomal and cell-surface entry of SARS-CoV-2bioRxiv - Microbiology 2024Quote: ... psPAX-2 (Addgene #12260) was used as a packaging plasmid ...
-
bioRxiv - Neuroscience 2021Quote: ... were performed over a 5 min period with 1 µL of AAV9-hSyn-Cre (Titer ≥ 1×10¹³ vg/mL, Addgene, Cat. No. 105553-AAV9) or un-injected ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2VP16 was generated by fusing the open reading frame for the herpes simplex virus-1 (HSV-1) VP16 (amplified from pActPL-VP16AD plasmid, Addgene plasmid #15305, Watertown, USA) activation domain to Err2 ...
-
bioRxiv - Microbiology 2020Quote: ... pLenti CMV Puro DEST (w118-1) and pLenti CMV Blast DEST (706-1) were gifts from Eric Campeau & Paul Kaufman (Addgene plasmids #17398, #17452, #17451). pMD2.G and psPAX2 were gifts from Didier Trono (Addgene plasmids #12259 ...
-
bioRxiv - Neuroscience 2024Quote: ... a 1:1 mix of AAV8-hSyn-OsTIR1(F74G)-P2A-mAID:EGFP:NES (plasmid from Yesbolatova et al., 2020, Addgene #140730, titer: 1.4 ∗ 1015 VG/mL) and AAV8-phSyn-H2B::mCherry (titer ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA#2: 5’-aacctgagtgatatgactag-3’) were cloned into a modified version of the lentiCRISPR v2 backbone (RRID: Addgene_52961) in which a puromycin resistance ORF was cloned under the hPGK promoter ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-DIO-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), AAVrg-pCAG-FLEX-tdTomato-WPRE (Titer ≥ 1×1013 vg.mL−1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was cloned into pLKO.1-Tet-Neo obtained from Addgene. For inducible shRNA constructs ...
-
bioRxiv - Cancer Biology 2020Quote: pLKO.1-puro (Addgene #52628, a gift from Scot Wolfe) and the modified pLKO.1-puro/GFP vector system described in (Phelan et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47802 (Addgene, catalog number: 48007). Level 1 pICH47811-pTCSn::nls:tGFP::tATPase (position 2 ...
-
bioRxiv - Plant Biology 2021Quote: ... in the level 1 vector pICH47811 (Addgene, catalog number: 48008). To amplify IPT3 promoter (gene ID v4 ...
-
bioRxiv - Microbiology 2020Quote: ... pLKO.1-puro-shNT (gift from Jacob Corn, Addgene #109012) was used as a scrambled shRNA control ...
-
bioRxiv - Cell Biology 2021Quote: ... and AdEasier-1 cells (gift from Bert Vogelstein; Addgene, #16399)
-
bioRxiv - Neuroscience 2021Quote: ... Animals were injected with saline-diluted AAV2/1.hSyn.GCaMP6f.WPRE.SV40 (Addgene) at a depth of 250 and 550 µm (final concentration ...
-
bioRxiv - Cancer Biology 2020Quote: ... pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 constructs were co-transfected with psPAX2 (Addgene 12260) and VsvG (Addgene 8454 ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb_EfrCD#1 was cloned into expression plasmid pBXNPHM3 (Addgene #110099) using FX cloning and expressed as described previously [42] ...
-
bioRxiv - Molecular Biology 2023Quote: ... the IMS using SMAC (residues 1-59, from Addgene 136469), the IBM using IMMT (residues 1-18734) ...
-
bioRxiv - Molecular Biology 2023Quote: ... in the Level 1 acceptor plasmids pL1P3-TaU6 (Addgene #165599) and pL1P4-TaU6 (Addgene #165600) ...
-
bioRxiv - Biochemistry 2023Quote: ... was mixed with packaging plasmids MD2G (1 μg, Addgene 12,259) and PSPAX2 (1 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Cat # AV-1-ALL854, RRID:Addgene_51502 ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-DIO-stGtACR2-FusionRed (Addgene, 4.2E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... to inject 1 μl pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 (Addgene, catalog # 105551-AAV9) or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... The following AAVs were injected: 1) AAV1.hSyn.cre.WPRE.hGh (Addgene #105553) at one of three doses (1.73×1012 ...
-
bioRxiv - Immunology 2022Quote: ... et al 16 were purchased from Addgene (Supplemental Table 1), and used to make stable expression cell lines in HEK293 cells by lentiviral transduction ...
-
bioRxiv - Neuroscience 2022Quote: ... Viral injections of 1 μl hSyn.iGluSnFr.WPRE.SV40 (Addgene, plasmid #98929-AAV1) for glutamate imaging or 1 μl pENN.AAV.CamKII.GCaMP6f.WPRE (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862 ...
-
bioRxiv - Neuroscience 2024Quote: ... viral injections of AAV2/1-CAMK1a-gCaMP6f (Addgene #100834-AAV1) were made into the binocular zone ...
-
bioRxiv - Neuroscience 2023Quote: ... DJ-1 (a gift from Mark Cookson, Addgene plasmid 29347), synapto-iATPSnFR2-miRFP670nano3 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg.Syn.jGCaMP7b.WPRE (Addgene, lot. no. v63074, titer 1 x 1013). For GCaMP expression in the DRG neurons ...
-
bioRxiv - Microbiology 2023Quote: pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 8453 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV9-CaMKIIa-EGFP (titer: 1×10¹³ vg/mL, Addgene) for chemogenetic silencing and viral control ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-Syn-GCaMP6m-RPL10a (1−1013 gc/mL; Addgene #158777) was injected into PM ...