Labshake search
Citations for Addgene :
501 - 550 of 3199 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and pMA122 (peel-1 negative selection; plasmid 34873; Addgene) into unc-119(ed3 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1 ...
-
bioRxiv - Cancer Biology 2021Quote: A modified pLKO.1 lentiviral vector (Addgene plasmid #27994), in which the puromycin marker gene was replaced by eGFP (for knockdown experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... A mixture with 1 µg VSV-G (Addgene, 8454), 1 µg psPAX2 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids used: pLKO.1 - TRC cloning vector (Addgene, # 10878)42 ...
-
bioRxiv - Biophysics 2020Quote: ... coli is pJCSUP35NM (1-253) (Addgene Plasmid number #1089). The over-expression of Sup35NM was induced using 1 M IPTG ...
-
bioRxiv - Genetics 2022Quote: ... and 1 µg VSV-G envelope plasmid (Addgene #8454) using 100 µL PEI in 1 mL serum-free DMEM and incubated at room temperature for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Microbiology 2021Quote: ... PLKO.1 TRC cloning vector was purchased from Addgene (gift from David Root ...
-
bioRxiv - Neuroscience 2020Quote: ... We injected 1 µl of AAV1 Syn::GCaMP6s (Addgene) at a titer of 1x1013 vg/mL in the auditory cortex of wild-type mice ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO.1 and pWPXLd plasmids were purchased from Addgene. shRNAs against Trp53 ...
-
bioRxiv - Physiology 2021Quote: ... the pLKO.1 cloning plasmid was obtained from Addgene, USA (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... pCMV6-XL4 ASXL1 (1-479) 3x FLAG (Addgene # 74262) were a gift from Anjana Rao ...
-
bioRxiv - Immunology 2021Quote: ... and HIV-1- gag-pol helper plasmid (pspax2, Addgene) using Lipofectamine 3000 according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and AdEasier-1 cells (#16399) were purchased from Addgene. Full length Rela gene was inserted into pShuttle-CMV with SalI and NotI to obtain pShuttle-CMV-Rela ...
-
bioRxiv - Cell Biology 2021Quote: The pLKO.1-Puro plasmid was purchased from Addgene. Small hairpin RNAs were cloned for generation of knockdown constructs (shRNAs ...
-
bioRxiv - Immunology 2023Quote: ... A scramble shRNA-expressing pLKO.1 (Addgene Plasmid #1864) was used as control (shScr) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shFF was cloned into pLKO.1-puro (Addgene #8453). For tet-inducible shRNA knock-down system ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin; Addgene cat no.18803). shRNA targeting RelA and SP1 were cloned into pLKO.1-Puro vector individually according to Addgene’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8m-WPRE (Addgene, 2.0E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hSyn-SF-iGluSnFR.A1848 (Addgene, 3E12 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: AAV2/1 hsyn-jGCaMP8s-WPRE (Addgene, 2.8E13 GC/ml)
-
bioRxiv - Neuroscience 2022Quote: ... or 1 μl pENN.AAV.CamKII0.4.eGFP.WPRE.rBG (Addgene, catalog #105541-AAV9) bilaterally into the dorsal hippocampus (injection rate ...
-
bioRxiv - Microbiology 2022Quote: ... the pLKO.1-TRC cloning vector (Addgene plasmid 10879) was digested with EcoRI and AgeI to release a 1.9kb stuffer ...
-
bioRxiv - Cell Biology 2022Quote: ... melanogaster KHC residues 1-559 (adapted from Addgene #129761), the Kin2 construct consists of the M ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1); pAAV5-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... we utilized the pAAV2/1 packaging plasmid (Addgene #112862), diverging from our previous use of the pAAV 2/8 or 2/9 plasmids ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene, 51502). The final injection coordinates for caudolateral PAG were ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The plasmid pLKO.1 GFP shRNA (Addgene, #30323, RRID:Addgene_30323) was a gift from David Sabatini (110).The targeting sequences are described in Supplemental Table S1 ...
-
bioRxiv - Systems Biology 2024Quote: ... or rabbit α-β-tubulin (Addgene ab6046, 1:10,000) as primary and HRP-α-Mouse (Cell Signaling ...
-
bioRxiv - Cancer Biology 2024Quote: ... shp53 pLKO.1 puro was purchased from Addgene (19119) (shp53 pLKO.1 puro was a gift from Bob Weinberg (Addgene plasmid # 19119 ...
-
bioRxiv - Neuroscience 2023Quote: We used the pLKO.1 vector (Addgene plasmid 10878)7 for expression of shRNA against rat Sirt3 (target ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere; Addgene). During the same surgery ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 μg VSVG (gift from Bob Weinberg, Addgene #8454)(67 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 µg of the packaging plasmid (psPAX2, Addgene #12260), and 2 µg of the envelope plasmid (pMD2.G / VSVG ...
-
bioRxiv - Cancer Biology 2024Quote: ... pLKO.1-Yap shRNA was obtained from Addgene (#166486) and used to knockdown YAP expression in BBN-induced cancer cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 1 μg of pCMV-VSV-G (Addgene #8454) using Lipofectamine 3000 reagent (Thermo) ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1.Syn-ChrimsonR-tdT (1 × 1013 GC/mL, Addgene viral prep #59171-AAV1 ...
-
High-resolution profiling reveals coupled transcriptional and translational regulation of transgenesbioRxiv - Synthetic Biology 2024Quote: ... 1 µg of the packaging plasmid (psPAX2, Addgene #12260), and 2 µg of the envelope plasmid (pMD2.G / VSVG ...
-
bioRxiv - Cancer Biology 2024Quote: shMAFG cells were generated using pLKO.1 (Addgene; 10878) cloned with shRNA sequences (Supplementary Table ...
-
bioRxiv - Microbiology 2024Quote: ... PLKO.1 TRC cloning vector was bought from Addgene (gift from David Root ...
-
bioRxiv - Neuroscience 2024Quote: ... and MacPNS.1-EF1a-DIO-mScarlet (capsid76 Addgene #185136) were used for anterograde mapping ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV5-hsyn-DIO-EGFP (Addgene, Catalog# 50457-AAV 1), pENN.AAV5.hSyn.TurboRFP.WPRE.RBG (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ShRNA knockdown was done with pLKO.1 (Addgene #10878) backbone ...
-
bioRxiv - Biochemistry 2024Quote: ... cells were transfected with pSFFV_mNG3K (1-10) (Addgene #157993). 36 hours after transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... sgRNA guides flanking Drp1 exon 2 or Mfn2 exon 3 were cloned into the PX459 vector (Addgene)60 ...
-
bioRxiv - Cancer Biology 2021Quote: ... #2: 5’-caccgTGAAACGGATTCTTCTTTCG-3’) and cloned into the Cas9 plasmids pSpCas9(BB)−2A-Puro (PX459, Addgene #62988) and pSpCas9(BB)-2A-GFP (PX458 ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Genetics 2023Quote: ... The germline licensed Cas9 and tbb-2 3’ UTR were amplified from pCFJ150-Cas9 (dpiRNA) (Addgene ID107940) (Zhang et al. ...