Labshake search
Citations for Addgene :
501 - 550 of 1353 citations for Mono 2 Carboxymethyl Hexyl Phthalate Cp 95% 13C4 99% Dehp Metabolite Iv 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2-hsyn-hM3Dq-mCherry (Addgene #50474-AAV2; 7.38 ×1012 vg/ml) was injected into the bilateral sensorimotor cortex at four sites (500 nL/point ...
-
bioRxiv - Neuroscience 2020Quote: AAV2-hSyn-DIO-hM4Di-mCherry (4.6 × 1012 vg/ml, Addgene, USA)
-
bioRxiv - Neuroscience 2020Quote: ... AAV2-hSyn-DIO-hM3D(Gq)-mCherry (5.8 × 1012 particles/mL; Addgene, Catalog number 44361-AAV2 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-DIO-hM3-mCherry (4×1012 vg/ml, Addgene 44362), AAV8-hSyn-hM4-mCherry (6×1012 vg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2-retro-AAV-CAG-tdTomato (Addgene, 7×10^12 gc/ml), Cholera toxin subunit B CF-640 (Biotium ...
-
bioRxiv - Neuroscience 2020Quote: pAAV.Syn.GCaMP6f.WPRE.SV40 virus (titer: 2.2 × 1013 GC/mL, obtained from AddGene, USA) was injected into dorsal hippocampus (AP -2.1 ...
-
bioRxiv - Neuroscience 2021Quote: ... 100-200 nL of rAAV2-retro jGCaMP7s (~1e13 gc/mL, Addgene) was injected at a rate of 70 nL·min-1 using a Microinject system (World Precision Instruments) ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 105622-AAV1, RRID:Addgene_105622), (3 ...
-
bioRxiv - Neuroscience 2020Quote: ... carrying the fluorescent calcium indicator GCaMP6f (AAV.Syn.Flex.GCaMP6f.WPRE.SV40, 1E13 particles/ml, Addgene) into the left VTA (AP ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of overnight culture containing pTXB1-Tn5 (Addgene plasmid #60240) was used to inoculate 1 L of ZYM-505 growth media containing 100 μg/mL ampicillin and 0.001% polypropylene glycol (L14699-AE ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV5-hSyn-DIO-mCherry (1012 particles/mL, plasmid #50459, Addgene) in the SNc of TH::Cre rats (20,21) ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 27056-AAV9, RRID:Addgene_27056),
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 20298-AAV9, RRID:Addgene_20298),
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1013 GC/ml (Addgene viral prep # 104487-AAV1, RRID:Addgene_27056)15.
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-CAG-GFP (Addgene, 37825-AAVrg, 7.0×1012 vg/mL). In a subset of the brains ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV viruses were pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene, 105554-AAV1, 1.9×1013 vg/mL), AAV9-syn-RFP (SignaGen ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-hSyn-EGFP (Addgene, 50465-AAV1, 1.1×1013 vg/mL). In different brains ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Systems Biology 2023Quote: ... we first digested mitochondrial matrix-localizing HyPer7 (pCS2+MLS-HyPer7, RRID:Addgene_136470) with BamH1 and XhoI and ligated into our lentiviral backbone (13) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-hSyn-eGFP (RRID:Addgene_50465, 300 nl at 2x 1013 GC/ml) were injected into the pontine nuclei to regrogradely label PT neuron in the motor cortex ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml, Addgene # 105553) virus was bilaterally infused onto the iCA1 (AP-2.75 ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-EYFP (1.0 × 1013 gp/mL) (Addgene #105622)
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361, vg/mL) were injected in Nav1.8 Cre animals in in the NTS (from bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer; 2.3 x1013 pfu/ml), AAVrg-FLEX-jGCamp7s (Addgene 104491 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer > 1 × 1013 pfu/ml) was used as control.
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...