Labshake search
Citations for Addgene :
751 - 800 of 1353 citations for Mono 2 Carboxymethyl Hexyl Phthalate Cp 95% 13C4 99% Dehp Metabolite Iv 100Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... titer: 4.5 × 1013 GC/ml (Cat # AV-1-ALL864, RRID:Addgene_51503; U Penn Vector Core).
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5.0 × 1012 GC/ml (Addgene viral prep # 162382-AAV9, RRID:Addgene_162382; Addgene, MA, U.S.A.),
-
bioRxiv - Neuroscience 2022Quote: ... a calcium indicator AAV9-hSyn-GCAmp6f-eYFP (Addgene, viral titer 2.8 × 1013 vg/mL) or a control virus AAV9-hSyn-eYFP (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... OXTR knock-out: AAV1 CMV-HleGFP-Cre (1.1 × 1013 vg/ml, Addgene, #105545-AAV1) or AAV2 hSyn-GFP (3.4 × 1012 vg/ml ...
-
bioRxiv - Physiology 2023Quote: ... HyPer7.24 The cDNA of pCS2+MLS-HyPer7 was purchased from Addgene (Plasmid ID: 136470) and was transfected in HAECs using the NeonTM Transfection System (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... or pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE (titre 2.1 x 1013 vg/ml, Addgene). 6s and 7f dopamine recordings were pooled in presented analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2-CAG-TdTomato (100 µL, 5.3 x 1012 GC/ml, Addgene 59462-AAV2) was injected intravitreally 4 mm posterior to the nasal aspect of the limbus ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV CAG-tdTomato (AAVrgTdT; Addgene 59462-AAVrg; 3μl of 4.6 x 1012 GC/ ml). Mice were split into 3 groups whereby group 1 had both vagi intact ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre-dependent pAAV-FLEX-tdTomato (2.1×1013 particles/ml; Addgene viral prep #28306-AAVrg) was injected into the same hemisphere at 0.7 mm anterior to Bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVDJ-EF1α -fDIO-hChR2-EYFP (2.19 x 1013 GC/ml, plasmid RRID:Addgene_55639, Vigene production) or AAV5-EF1α-DIO-EYFP (6.5 x 1012 GC/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) or a control virus (AAV2-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... 300uL of AAVrg-Ef1a-mCherry-IRES-Cre-WPRE (Addgene 55632-AAVrg, 1.7x1013 vg/mL) was injected unilaterally into either left NAc (AP ...
-
bioRxiv - Neuroscience 2023Quote: ... and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40, titer≥1×10¹³ vg/ml Addgene 105558-AAV9) virus was injected in S1 barrel cortex ...
-
bioRxiv - Neuroscience 2023Quote: ... pCyPet-Rac1(T17N)) and AAV-GFP (pAAV.CMV.PI.EGFP.WPRE.bGH; 1.6x1013 vg/ml) were purchased from Addgene. AAV-GFP was diluted to match the concentration of AAV-Rac1-DN.
-
bioRxiv - Neuroscience 2023Quote: ... Approximately 0.2uL of pAAV5-hSyn-hM4D(Gi)-mCherry (≥ 7 x 1012vg/mL, Addgene # 50475), pAAV5-hSyn-mCherry (≥ 7 x 1012vg/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... we used pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (viral titer/ml: 3.2 x 10^13, Addgene 100854-AAV9), pCAG.DIO.GPHN.FingR.EGFP2F (viral titer/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361-AAV8, 2.9 x 1013 vg/ml) or AAV8-hSyn-DIO-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: Calcium indicator GCaMP6f (AAV1-Synapsin-GCaMP6f-WPRE-SV40, Addgene 100837-AAV1; 6.52 ×1012GC/ml) was injected using the same procedure at 4.5-5 months after injection of AAV-GFAP-htTau or AAV-GFAP-Control ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 OTp-hM3Dq-Myc (2.9 × 1012 gp/mL) (Corresponding plasmid: Addgene #184753)84
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Neuroscience 2024Quote: ... or AAV1-CAG-FLEX-tdTomato (Addgene 28306-AAV1; titer: 1.0 x 1012 vg/mL) into bilateral BLA at coordinates anteriorposterior (AP) ...
-
bioRxiv - Neuroscience 2024Quote: ... 1μL of AAVrg-hSyn-hM3D(Gq)-mCherry (Addgene, #50474-AAVrg, 2.5×1013 GC/ml) or AAVrg-hSyn-hM4D(Gi)-mCherry (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-phSyn1(S)-FLEX-TdTomato-T2A-Syp-EGFP (Addgene #51509, 4 x 1014GC/mL) was injected (60nL at 20nL/min ...
-
bioRxiv - Neuroscience 2024Quote: ... we unilaterally injected 450 nL AAV9-hSyn-flex-GCaMP7s (≥ 1×10¹³ vg/mL, Addgene)107 into lAcbSh ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV1-Syn-Chronos-GFP (Chronos, 2.90e+13 gc/mL, 250 nL, Addgene #59170-AAV1), AAV-syn-FLEX-jGCaMP7b-WPRE (FLEX-GCaMP7b ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Neuroscience 2021Quote: ... and sg-KCTD16-2 (5’-TTCCGCAAACCAAAATCCGG-3’) were then cloned into the AAV-U6-sgRNA-hSyn- mCherry plasmid (RRID:Addgene_87916) using the SapI site 5’ of the gRNA scaffold ...
-
bioRxiv - Molecular Biology 2020Quote: ... These parental BV2 or BV2-Cas9 cells were transduced for 2 d with pXPR_011 lentivirus expressing eGFP (Addgene; 59702) and an sgRNA targeting eGFP at a multiplicity of infection (MOI ...
-
bioRxiv - Systems Biology 2021Quote: ... We generated two independent miR-290-295_KO mESC lines by transfecting WT E14 mESCs with pX458-sgRNA_miR290-295_3/2 for KO1 (Addgene #172711, #172710) and pX458-sgRNA_miR290-295_1/2 for KO2 (Addgene #172709 and #172710) ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Microbiology 2021Quote: ... pCDNA3.1-SARS2-Spike expressing full-lengh Spike (S) protein from SARS-CoV-2 (GenBank accession number QHD43416.1) was purchased from Addgene. Expression plasmid encoding S protein from SARS-CoV (GenBank accession number AAP13567.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... Two closely spaced NHSL1 specific sgRNA (sgRNA1: caccgTCGACTCTCCTCGTCCAAGT; sgRNA2: caccgCTGTCCACTACACGGCACCA) were designed using http://crispr.mit.edu and cloned into pX330S-2 (Addgene 58778) and pX330A_D10A_x2 (Addgene 58772 ...
-
bioRxiv - Molecular Biology 2022Quote: The lentiviral vectors pLVX-EF1alpha-IRES-Puro-2xStreg-SARS-CoV-2 (Nsp6, Nsp8, M) (Addgene plasmids #141395, #141372, #141374) were transfected into the HEK293T cells with packaging plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: ... SCD ORF was cloned in pLenti PGK Puro DEST 5W(w529-2) (gift from Eric Campeau & Paul Kaufman73; Addgene plasmid #19068 ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Microbiology 2021Quote: ... The pcDNA-FLAG-V5-Nsp10/14/16 vectors were constructed from pDONR223 SARS-CoV-2 Nsp10 (Cat. # 141264, Addgene), Nsp14 (Cat ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Immunology 2021Quote: ... Virus was harvested from GP-2 cells transfected with SINV vectors and VSV-G (pMD2.G, Addgene plasmid #12259) and grown in DMEM supplemented with 30% FBS and 2mM glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs from the library (Supplemental Table 2) were annealed and cloned into a pLKO.1_neo plasmid (a gift from Sheila Stewart; Addgene plasmid # 13425 ...
-
bioRxiv - Neuroscience 2020Quote: ... mEos3.2-C1 was a gift from Michael Davidson & Tao Xu (Addgene plasmid # 54550; http://n2t.net/addgene:54550; RRID: Addgene_54550). Vcl-T-mEOS3.2-LifeAct was generated by sub-cloning a Vcl-T-T2A fragment in mEOS3.2-LifeAct clone.
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Molecular Biology 2022Quote: ... psPAX2 packaging vector (2 µg, a gift from Didier Trono; Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260), and pMD2G envelope plasmid (4 µg ...
-
bioRxiv - Molecular Biology 2022Quote: A single guide RNA (sgRNA) (GCAGTGACTGTGTACGTGAG) that targets exon 2 of eIF2D was cloned into lentiCRISPR v2 plasmid (Addgene). HEK293 cells were plated into 6-well plates at 4 × 105 cells per well ...
-
bioRxiv - Cell Biology 2022Quote: ... Tagging of the endogenous locus of SMC3 was done according to the CRISPaint protocol57 using 2.5 μg frame selector plasmid (pCAS9-mCherry-Frame+2; Addgene_6694157), 2.5 μg target selector plasmid (pCS446_pSPgSMC3 ...
-
bioRxiv - Immunology 2023Quote: The expression construct used to generate SARS-CoV-2 spike protein was a gift from Jason McLellan (Addgene #154754). Spike protein was prepared as previously described in20 ...
-
bioRxiv - Systems Biology 2023Quote: ... psPAX2 packaging vector (2 μg, a gift from Didier Trono (Addgene plasmid #12260; http://n2t.net/addgene:12260; RRID: Addgene_12260)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDONR207 SARS-CoV-2 NSP1 was a gift from Fritz Roth (Addgene plasmid # 141255; http://n2t.net/addgene:141255; RRID: Addgene_141255). NSP1 coding sequence was cloned into the mammalian expression pCDNA5-FRT/TO-2xSTREP-3xHA vector ...
-
bioRxiv - Genomics 2022Quote: ... Each 15-cm2 plate was transfected with a total of 21 μg of plasmid DNA (1:2:1 ratio psPAX2-D64V:pLenti-STARR:pLAI-Env) [psPAX-D64V (Addgene #63586), and pLAI-HIV (Addgene #133996)] ...
-
bioRxiv - Neuroscience 2023Quote: ... and after 2 weeks of expression injected AAV8-EF1a-Con-Foff 2.0-GCamp6m-WPRE into PL (Addgene 137120-AAV8). For recordings from PL-VTA neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... were ordered from Sigma Aldrich as oligonucleotides (Table 2) and were cloned into pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid #48138 ...