Labshake search
Citations for Addgene :
451 - 500 of 2505 citations for Dickkopf related protein 1 DKK 1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2022Quote: ... Each shRNA was cloned into the host pLKO.1-puro vector. PLKO-shFOXA1#1 (Cat. #: 70095) and PLKO-shFOXA1#2 (Cat. #: 70096) were obtained from Addgene, and previously used 45 ...
-
bioRxiv - Cell Biology 2023Quote: PARP-1 sgRNAs (#1, GTGGCCCACCTTCCAGAAGC; #2, ATACCAAAGAAGGGAGT-AGC) were synthesized and subcloned into lenti-CRISPR vector (Addgene, pXPR_001, plasmid 49535). Lentiviral vectors were co-transfected into HEK293FT cells with the lentivirus packaging plasmids pVSVg and psPAX2 using FuGENE® HD ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Neuroscience 2023Quote: ... we used a 1:1 combination of AAV8-CaMKIIα-GFP-Cre (UNC) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Cat. #44362, Addgene).
-
bioRxiv - Neuroscience 2023Quote: ... slices were virally infected with 0.5-1 µl AAV mixture per slice (containing AAV9-Camk2a-Cre at 2 × 1012 vg/ml (1:1000 dilution, Addgene and rAAV8-DIO-CBA-pAAIP2-mEGP at 4.2 x 1012 vg/ml ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... with 0.5 µg of either a 1:1 mixture of the S plasmids and a Jun-Nt Venus fragment (Addgene 22012) plasmid or a mixture of hACE2 plasmid (kindly provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Biochemistry 2024Quote: ... The Venus-PDZ1 (ZO-1) was generated by site directed mutagenesis of the Venus-ZO-1 expression vector (Addgene: 56394) using primer pairs that delete the entire ZO-1 coding sequence except for the first PDZ1 domain ...
-
bioRxiv - Neuroscience 2021Quote: ... The pLKO.1-TRC cloning vector (RRID: Addgene_10878) and the pLKO.1-sh-Ctl (RRID ...
-
bioRxiv - Neuroscience 2021Quote: ... and the pLKO.1-sh-Ctl (RRID: Addgene_10879) were kindly provided by Marian Martínez-Balbás ...
-
bioRxiv - Cell Biology 2021Quote: ... to either pLKO.1 puro (Addgene Plasmid #8453) for constitutive knockdown or Tet-pLKO-puro (Addgene Plasmid #21915 ...
-
bioRxiv - Genetics 2021Quote: ... and 1 μg CMV-SB10 (Addgene plasmid # 24551) via the tail vein in 5-7 s ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 1 μg pCAGGS-mCherry (Addgene, plasmid #41583) (45) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Using 1 ng pCFD6 (Addgene, Cat. No: 73915) as template ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 μL of LSL-tdTomato (Addgene#: 100048); 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid pIRES2-eGFP (Addgene, Cat#6029-1) was used as transfection control ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCAFNF-tdTomato (Addgene#125575, 1 μg/μL) were used ...
-
bioRxiv - Microbiology 2020Quote: ... and pcDNA3.1-V5-hMcl-1 (Addgene plasmid #25375) were purchased from Addgene (Cambridge ...
-
bioRxiv - Genomics 2021Quote: ... and 1 µg of pMD2.G (Addgene, 12259) lentivirus packaging plasmids into 8 million HEK293T cells in a 10-cm dish with PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1 μg pMD2.G (Addgene plasmid, 12259) combined with the overexpression vectors H2B-cherry ...
-
bioRxiv - Cell Biology 2022Quote: ... together with 1 μg pVSV-G (#138479, Addgene) and 2 μg psPAX2 (#12260 ...
-
bioRxiv - Cell Biology 2022Quote: ... HSV-1 UL12.5 was purchased from Addgene (#70109) and the EGFP was removed by subcloning ...
-
bioRxiv - Immunology 2022Quote: ... then ligated into pLKO.1 vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Microbiology 2022Quote: ... and pLVX or pLKO.1 transfer plasmids (Addgene) using jetOPTIMUS according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... KIF5C(1-560)-2xmCh-EF(C) (Addgene #61664) and KIF5C(1-560)-mCit (Addgene #61676 ...
-
bioRxiv - Genomics 2023Quote: ... and 1 μg of pMD2.G (Addgene, 12259) packaging plasmids were cotransfected into 8 million HEK293T cells in a 10-cm dish supplemented with 36 μl PolyJet (SignaGen Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentiviral cloning vector pLKO.1-TRC (Addgene, #10878) was used for shRNA expression ...
-
bioRxiv - Genetics 2023Quote: ... anti-Na/K-ATPase (1:1000, Addgene #180089) (membrane protein loading control) ...
-
bioRxiv - Cell Biology 2023Quote: ... and the pLKO.1 plasmid (Addgene, Cambridge, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Cell Biology 2023Quote: ... For lentiviral transfections 1 μg VSVG (Addgene #8454) and 1.86 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Genetics 2024Quote: ... mixed with 1 μg of PsPax2 (Addgene # 12260), 1 μg of the lentiviral transfer vector G1088E_pLenti-CMV-mNeonGreen-2A-HygroR (Addgene #216279) ...
-
bioRxiv - Neuroscience 2021Quote: ... was mixed 1:1 with the retrogradely trafficked AAV encoding eGFP (AAVrg-hsyn-EGFP, 7.4 × 1012 vg/mL; Addgene, Watertown, MA) and infused into the BLA (AP ...
-
bioRxiv - Neuroscience 2021Quote: 50 nL of AAV1 particles (titer 1 × 1012 cfu mL−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene.org #20298) was injected into L5 of S1 (co-ordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: 50 nl of AAV1 particles (titer 1 × 1012 cfu ml−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene #20298) was injected unilaterally into the L5 of S1 (coordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... were added to each well along with 1 μl of Syn1-EBFP-Cre (serotype, 2-1; titer, 6×1012 genomes/mL; MOI, ∼8-0.08; Addgene, 51507-AAV1) delivered at full strength or diluted 1:103-104 ...
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN glia AAV-5: pZac2.1 gfaABC1D-cyto-GCaMP6f at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Neuroscience 2020Quote: Raphe and RTN neurons - AAV-9: pGP-AAV-syn-GCaMP6s-WPRE.4.641 at a titre of 1×1013 GC·ml- 1 (Addgene, Watertown, MA, USA);
-
bioRxiv - Developmental Biology 2021Quote: ... plasmid was created by Infusion cloning of CMV-GFP(1-10) from pcDNA3.1-GFP(1-10) (a gift from Bo Huang (Addgene plasmid # 70219) into a pUC57 backbone ...
-
bioRxiv - Biophysics 2020Quote: ... 1 µg of HRD plasmid and 1 µg of AAVS1 T2 CRISPR plasmid (a gift from Masato Kanemaki, Addgene plasmid #72833) were transfected into U2OS cells using FuGENE HD (Promega ...
-
bioRxiv - Microbiology 2021Quote: Chemical-genetic screens were initiated by thawing 5 × 1 mL (1 OD600 unit per mL) aliquots of the Mtb CRISPRi library (RLC12; Addgene #163954) and inoculating each aliquot into 19 mL 7H9 supplemented with kanamycin (10 μg/ml ...
-
bioRxiv - Molecular Biology 2021Quote: ... and YTHDC1 were generated by cloning the shRNA (RNAi Consortium shRNA Library) from pLKO.1-puro into the pLKO.1-blast backbone (Addgene #26655).
-
bioRxiv - Molecular Biology 2020Quote: ... pCGN-ATF6 (1-373) and pCGN-ATF6 (1-373) m1 were gifts from Professor Ron Prywes (Addgene plasmid 11974, 27173, 27174).
-
bioRxiv - Cell Biology 2022Quote: ... pBa-Kif1A(1-396)-tdTomato-FKBP was generated by Asc1/Hpa1 restriction digest of pBa.Kif1a 1-396.GFP (backbone; Addgene, Cat #45058) and of pBa-KIF5C 559-tdTomato-FKBP (insert ...
-
bioRxiv - Cell Biology 2020Quote: ... pDEST-swiprosin-1-V2 was generated by performing a clonase reaction between pCR8GWTopo-swiprosin-1 and pDEST-ORF-V2 (Addgene 73638). pEF.DEST51-mVenus was obtained from Addgene (plasmid #154899).
-
bioRxiv - Neuroscience 2020Quote: pFL - AAV-9: pGP-AAV-syn-GCaMP6f-WPRE.24.693 at a titre of 1×1013 GC·ml-1 (Addgene, Watertown, MA, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The two pools were then combined at a 1:1 ratio and cloned into a doubled digested (AgeI/SbfI) pLS-SceI vector (Addgene, 137725) with NEBuilder HiFi Master Mix (NEB) ...