Labshake search
Citations for Addgene :
451 - 500 of 1702 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: GFP-tagged galectin 3 (pEGFP-hGal3 (Addgene, plasmid no. 73080) was mutated using the Q5 site directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2022Quote: ... and (3) mKok amplified from pCS2+ ChMermaid S188 (Addgene 53617) with the CAAX membrane tag sequence (Sutcliffe et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 3 µg MSCV CreERT2 puro (Addgene, 2276 ref (18)) and polybrene (8 µg/mL ...
-
bioRxiv - Biochemistry 2020Quote: pHA#852: mec-4p∷FynY531F∷unc-54 3’UTR (Addgene ID ...
-
bioRxiv - Neuroscience 2021Quote: ... The 1208 bp rab-3 promoter sequence (Addgene Plasmid #110880) was inserted directly upstream of the N-terminal TOMM-20 coding region ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 3 μg pMD2.G (gift from Didier Trono, Addgene #12259), 12 μg of pCMV delta R8.2 (gift from Didier Trono ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TGFBR2 (5’-ccttgtagacctcggcgaag-3’) cloned into LentiCRISPRv2 puro (Addgene) (20) ...
-
bioRxiv - Microbiology 2022Quote: ... were generated by annealing two primers ordered from IDT DNA and cloned using BbsI into pKSB-sgRNA (Addgene #173671—3) vectors containing the U6 snRNA polymerase III promoter (AGAP013557) ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2023Quote: Toronto Knockout Version 3 library was purchased from Addgene (#90294) (26) ...
-
MYB68 orchestrates cork differentiation by regulating stem cell proliferation and suberin depositionbioRxiv - Plant Biology 2024Quote: ... and 3) the P336-FBP_11 vector (Available from AddGene (#139702)) ...
-
bioRxiv - Genetics 2024Quote: ... gfp and unc-54 3’UTR from pPD95.75 (Addgene #1494) using primers P29 and P30 ...
-
bioRxiv - Cancer Biology 2024Quote: ... or shRNAs against YAP (5’-CCGGAAGCTTTGAGTTCTGACATCCCTCGAGGGATGTCAGAACTCAAAGCTTTTTTTC -3’, cat. 27368, Addgene, pLKO1-shYAP1 was a gift from Kunliang Guan ...
-
bioRxiv - Genetics 2024Quote: ... with the dU6:3 promoter from pCFD3 (Addgene #49410, [19]). A synthetic gene fragment containing the anti-CRISPR AcrIIa4 codon-optimized for Drosophila was attached downstream of the ϕC31[2] integrase (from pBS130 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mCherry-ER-3 (a gift from Michael Davidson - Addgene plasmid # 55041 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rpb7 was PCR amplified from HEK293T cDNA with primers to introduce a Shine-Delgarno sequence and a C-terminal 6x-His tag and cloned into the EcoRI and NotI sites of pGEX4T1-Rpb4 using T4 DNA ligase to generate pGEX4T1-Rpb4/7 (Addgene #138484).
-
bioRxiv - Microbiology 2021Quote: ... was synthesized by Integrated DNA Technologies (IDT, Coralville, IA) and cloned into the mEGFP-Lifeact-7 mammalian expression plasmid (Addgene #54610), replacing Lifeact and appending a 3x HA tag ...
-
bioRxiv - Microbiology 2020Quote: RAW 264.7 cells stably expressing FL-Cas9 were generated by transducing RAW 264.7 cells with lentivirus containing LentiCas9-Blast (Addgene plasmid #52962)(Sanjana et al. ...
-
bioRxiv - Neuroscience 2021Quote: U118-MG astrocytoma cells were transfected with the F-actin marker mCherry-LifeAct-7 plasmid (gift from Michael Davidson, Addgene #54491) using a calcium phosphate precipitation protocol.24 LifeAct-7 is a 17 amino acid peptide that binds to the actin cytoskeleton ...
-
bioRxiv - Microbiology 2020Quote: ... Huh-7 Tet on cells were generated by transduction of Huh-7 cells with lentivirus generated using the pCW57.1 plasmid (gift from David Root, Addgene plasmid # 41393).
-
bioRxiv - Immunology 2021Quote: ... The full CD3-CD90.2 insert was further subcloned into the pMX vectors with different promoters using BamHI and HindIII (Addgene #163334-7).
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were co-transfected with vectors the ORF3a proteins and the vector or 4xmts-Neon-Green (mitochondria; Addgene, #98876). At 48 h post-transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... we generated small guide RNAs to PAM sites in proximity to exons 4 and 7 of the murine Grik3 locus and cloned these into the pSpCas9(BB)-2A-GFP (PX458) backbone (Addgene #48138), where expression of the sgRNAs is controlled under the U6 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... PV-cre mice received unilateral injections in the left lobule simplex of 0.7 µl of pAAV-1-hSyn1-Flex-SIO-stGtACR2-FusionRed-dlox (N = 5, 2.0 × 1012 genome copies/mL; Addgene: 105677-AAV1), while another group of PV-cre mice received injections of pAAV-9/2-hSyn1-dlox-tdTomato-dlox-WPRE (N = 3 ...
-
bioRxiv - Neuroscience 2024Quote: ... An intersectional approach was used for selective activation of mPFC to BLA projection using chemogenetics: 1) retrograde AAV encoding FlpO (0.3 μL, titer ≥ 7 x 1012 GC/ml, Addgene# 55637; RRID:Addgene_55637) were bilaterally injected into BLA (A-P ...
-
bioRxiv - Molecular Biology 2022Quote: ... The plasmid encoding 2×FKBP-GFP-Rab29 was generated by transferring 2×FKBP sequence from Addgene plasmid #20149 into Hind III site of pCMV10 plasmid followed by inserting EGFP-Rab29 sequence into Not I - Xho I site of pCMV10 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-GCaMP7b (2 × 1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 in saline) for imaging of pulvinar axons ...
-
bioRxiv - Molecular Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-SARS2-Spike (2) and pcDNA3.1-hACE2 (2) were obtained from Addgene (Addgene plasmids #145032; #145033); pCI-SARS2-Spike expressing a codon optimized version of the gene coding for S protein of SARS-CoV-2 was provided by Nicolas Escriou (Institut Pasteur) ...
-
bioRxiv - Cell Biology 2023Quote: ... Level 2 assembly was performed using the Level 2 acceptor pGoldenGreenGate-M (pGGG-M) (Addgene #165422) binary vector (Smedley et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (BPA ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pCMV-VSVG (Addgene 8454), 2 μg pMDLg/pRRE (Addgene 12251) ...
-
bioRxiv - Cancer Biology 2021Quote: ... or lentiCRISPRv.2-hygro (Addgene 98291). Validation of guide specificity was assessed by Western blot of low-passage cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pMDLg/pRRE (Addgene 12251), 2 μg pRSV-Rev (Addgene 12253) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μg pRSV-Rev (Addgene 12253), and 2 μg lentiviral plasmid carrying transgene (LeGO iG-CDK4R24C ...
-
bioRxiv - Immunology 2021Quote: ... 2 µg PMD2G plasmids (12259, Addgene), 40 µL of P3000 Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µL of plasmid (#JS825, Addgene) was diluted in 200 µL Xfect transfection reagent (631317 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg pMD2.G (Addgene 12259) and 1 µg psPAX2 (Addgene 12260 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μg pMD2.G (Addgene 12259) and 1 μg psPAX2 (Addgene 12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... and pX330S-2-PITCh (Addgene #63670) were combined with guide RNAs (gRNAs ...
-
bioRxiv - Biochemistry 2024Quote: ... and pX330S-2-PITCh (63670, Addgene), expressing Cas9 nuclease and two gRNAs (see below for sequences ...
-
Targeted Perturb-seq Reveals EGR1 and FOS as Key Regulators of the Transcriptional RAF-MAPK ResponsebioRxiv - Systems Biology 2024Quote: ... 2 μg pMD2.G (Addgene #12259), and 36 μL Turbofect (Thermo Fisher ...
-
bioRxiv - Microbiology 2023Quote: ... and (2) pEVOL-pBpF (Addgene #31190), which encodes a tRNA synthetase/tRNA pair for the in vivo incorporation p-benzoyl-l-phenylalanine (Bpa ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2 μg psPAX2 (#12260, Addgene) packaging plasmid by using polyethylenimine (Xiang et al ...
-
bioRxiv - Microbiology 2022Quote: ... or 2-AT (Addgene #29665; untagged).
-
bioRxiv - Cell Biology 2020Quote: ... we generated derivatives of pCFD5:U6:3-t::gRNA (Addgene, #73914). A first derivative (pCFD5:U6:3-t::gRNA_pst-1 ...
-
bioRxiv - Genetics 2021Quote: Calu-3 cells were transduced with lenti Cas9-Blast (Addgene #52962), or with lenti dCAS-VP64_Blast (Addgene #61425) ...
-
bioRxiv - Neuroscience 2022Quote: ... a 3:1 mixture of AAV-CAG-Flex-oG (Addgene #74292) and ΔG-Rab-GFP was injected into either the GS or TA muscles of P1-P2 pups ...