Labshake search
Citations for Addgene :
251 - 300 of 1702 citations for 3 7 Diethyl 2 hydrazinoquinoline hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 3 μg of pGW-PervevalHR (Addgene #57432) (22) ...
-
bioRxiv - Immunology 2021Quote: ... myc (pCSF107mT-GATEWAY-3’-Myc tag, Addgene), green fluorescence protein (GFP ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of psPAX (Addgene, 12260) and 1 μg of pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... +0.4 ML with diluted (1:3; Addgene) 4 × 0.15 μL of AAV9-Synapsin-jGCaMP7f-WPRE (Addgene) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MAFA in pX330S-3 (Plasmid #58779, Addgene), Insulin in pX330S-4 (Plasmid #58780 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 μg of pVSVg (8454; Addgene); FuGENE HD transfection reagent (Promega ...
-
bioRxiv - Genetics 2022Quote: ... Tc’hsp5’-Gal4Delta-3’UTR] (Addgene plasmid # 86449) was used as a donor plasmid with Piggybac insertion repeats and the 3xP3::EGFP reporter (Schinko et al. ...
-
bioRxiv - Physiology 2023Quote: ... and mPlum-mito-3 (Addgene plasmid #55988) using Fugene6 (Promega Inc. ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3β (Addgene #13270), pcDNA-HA-14-3-3σ (Addgene #11946 ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ε (Addgene #116886), pCS2-HA-14-3-3ζ (Addgene #116888 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA-HA-14-3-3σ (Addgene #11946) and pGEX-4T2-14-3-3 tau (θ ...
-
bioRxiv - Immunology 2024Quote: ... pCS2-HA-14-3-3ζ (Addgene #116888) and pCS2-HA-14-3-3η (Addgene #116887 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The N-Terminal pFLAG 3 vector (Addgene) was employed for cloning the DCLK1 DCX DNA by restriction digest ...
-
bioRxiv - Cell Biology 2024Quote: ... the vector pET-28a (#69864-3, Addgene) was amplified using 5’-GAAGCGGCCGCCCCGTCTCGTCTGGAAGAAGAACTGCGTCGTCGTCTGACCG AATAACACCACCACCACCACCACCACTGAGATCCGGC and 5’-GCCGGATCCGTGATGATGATGATGATGGCTGCTGCCC to introduce NotI and BamHI restriction sites into the vector backbone ...
-
bioRxiv - Neuroscience 2024Quote: ... n=2) or AAV9.EF1a.dflox.hChR2(H134R).EYFP.WPRE.HGH (1×10^12 pp/mL, Addgene, cohort 2, n=2). Subject mice were additionally injected in vCA2 (AP −3.0 ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cell Biology 2020Quote: ... 25 ng/µl of co-injection marker pCFJ104 (Pmyo-3:mCherry:unc-54 3’UTR, a gift from Erik Jorgensen, Addgene plasmid #19328 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.1 was amplified from the pCNcam2.1 with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-CTGACCAAGGTGCTGAAACT-3’and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.1 ...
-
bioRxiv - Neuroscience 2022Quote: ... The cDNA of Ncam2.2 was amplified with 5’-ACCATGAGCCTCCTCCTCTCC-3’ and 5’-TCTCTGATCAGGGAGTACCA-3’ and cloned into pWPI (Plasmid #12254, Addgene) within PmeI site to obtain the pWPI-NCAM2.2.
-
bioRxiv - Neuroscience 2022Quote: ... A pcDNA3 flag HA 14-3-3 β plasmid was a gift from William Sellers (Addgene plasmid # 8999; http://n2t.net/addgene:8999; RRID:Addgene_8999). All plasmids were verified by Sanger sequencing and/or long-read sequencing (Iowa IIHG Genomics core or Plasmidsaurus ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Molecular Biology 2024Quote: ... SK-BR-3 HER2-knockout (SK-BR-3 KO) were obtained using pSpCas9 BB-2A-Puro (PX459) V2.0 (9200 bp, Addgene) containing a sgRNA sequence (5’-TCATCGCTCACAACCAAGTG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... were constructed by inserting annealed synthetic oligomers (5′-CACCgcagctcctgcctctcatcg-3′ and 5′-AAACcgatgagaggcaggagctgc-3′) into the Bbs I site of pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (#42230; Addgene, Watertown ...
-
bioRxiv - Biochemistry 2024Quote: Synthetic complementary oligos targeting POLDIP2 (5’-CACCGCGCGTCGTCGTGGTCGACGC-3’ and 5’-AAACGCGTCGACCACGACGACGCGC -3’) were cloned into PX459-SpCas9 (Addgene, (35)) at the BbsI site ...
-
bioRxiv - Genetics 2024Quote: ... We transduced hiPSCs from two control donors (553-3, male; 3182-3, female) with lentiviral pUBIQ-rtTA (Addgene #20342) and tetO-NGN2-eGFP-NeoR (Addgene #99378 ...
-
bioRxiv - Cell Biology 2022Quote: ... mCardinal-Lifeact-7 was a gift from Michael Davidson (Addgene plasmid # 54663 ; http://n2t.net/addgene:54663 ; RRID:Addgene_54663). Vectashield antifade mounting medium (Vectorlabs ...
-
bioRxiv - Cell Biology 2022Quote: ... The mCh-NLS plasmid was generated by Michael Davidson and obtained from Addgene (mCh-Nucleus-7, #55110). The pericentrin-RFP plasmid (Gillingham & Munro ...
-
bioRxiv - Cancer Biology 2022Quote: ... mEmerald-Rab11a-7 was a gift from Michael Davidson (Addgene plasmid #54245; http://n2t.net/addgene:54245; RRID:Addgene_54245). pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806 ...
-
bioRxiv - Neuroscience 2020Quote: The alrm-QF2 line was generated by subcloning the enhancer region into pPTQF#7-hsp70 (Addgene# 46136) using EcoRI and BamHI ...
-
bioRxiv - Neuroscience 2020Quote: ... A cohort of SOM.iPKR and PKCδ.iPKR mice were injected with bilaterally in CeL with 200 nl of AAV.Eef1a1 Pr.DIO.EGFPL10a (7 × 10^^12 GC/ml, Addgene) for immunohistochemistry experiment; ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 nl of AAVretro-EF1a-mCherry-IRES-Flpo obtained from Addgene (titer, 7 x 10e12 vg/mL) was unilaterally injected in the basal forebrain (0.25 mm AP ...
-
bioRxiv - Cell Biology 2020Quote: ... mCherry-Nucleus-7 plasmid was generated by Michael Davidson and obtained from Addgene (Addgene plasmid no. 55110). Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen) ...
-
bioRxiv - Cell Biology 2021Quote: ... mCherry-Rab5a-7 was a gift from Michael Davidson (Addgene plasmid # 55126; http://n2t.net/addgene:55126; RRID:Addgene_55126) PH-Btk-GFP was a gift from Tamas Balla (Addgene plasmid # 51463 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The GFP1-10 and GFP11×7 fragments were obtained from plasmids pcDNA3.1-GFP(1-10) (Addgene: 70219) and pACUH-GFP11×7-mCherry-α-tubulin (Addgene ...
-
bioRxiv - Biophysics 2020Quote: ... The sequence was then excised with XbaI and HindIII and inserted into pT7-7 plasmid (Addgene #36046) between the XbaI and HindIII restriction sites to generate a plasmid template construct (pT7-fastFISH (pT7-fF)).
-
bioRxiv - Cell Biology 2024Quote: ... and 7 µg pMD2.G (gift from Didier Trono, Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID:Addgene_12259) using JetPEI (Polyplus Transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV-hSyn-EGFP a gift from Bryan Roth (titer ≥ 7×10¹² genome copies per ml; Addgene viral prep # 50465-AAV1 ...
-
bioRxiv - Biophysics 2023Quote: ... EGFP-Vimentin-7 was a gift from Michael Davidson (Addgene plasmid #56439; http://n2t.net/addgene:56439; RRID:Addgene_56439).
-
bioRxiv - Cell Biology 2022Quote: ... mCherry-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid #55127; http://n2t.net/addgene:55127; RRID:Addgene_55127). Lamp1-RFP62 was a gift from Walther Mothes (Addgene plasmid # 1817 ...
-
bioRxiv - Neuroscience 2022Quote: mRuby-Mito-7 was a gift from Michael Davidson (Addgene plasmid #55874; http://n2t.net/addgene:55874; RRID:Addgene_55874). mRuby-ER-5 was a gift from Michael Davidson (Addgene plasmid #55860 ...
-
bioRxiv - Neuroscience 2022Quote: ... for optogenetic control: Two 400 nl injection of AAV2retro-GAG-ChR2 (Addgene 28017, 7 × 1012 VG/ml) or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669 ...
-
bioRxiv - Cell Biology 2023Quote: ... mTagBFP-Nucleus-7 was a gift from Michael Davidson (Addgene plasmid # 55265 ; http://n2t.net/addgene:55265 ; RRID:Addgene_55265). TCAB1 was knocked-out using a single sgRNA or two separate sgRNA and Cas9 encoding plasmids that were transfected alongside a GFP-expressing plasmid ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the LPutopia-8 genome-targeting vector was constructed based on the earlier version LPutopia-7 (Addgene #199212) assembled in the previous studies28 ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: GFP11 and GFP11×7 plasmids from DNA preparation step in the appropriate reading frame (RRID: Addgene_172068, Addgene_172067). Ten-m is found is phase 1 thus it is possible to use the AddGene plasmids for GFP11 insertions ...
-
bioRxiv - Cell Biology 2024Quote: ... mEmerald-Rab7a-7 was a gift from Michael Davidson (Addgene plasmid # 54244; http://n2t.net/addgene:54244 ; RRID:Addgene_54244). TBC1D5 shRNA lentivirus (GeneCopoeia #LPP-RSH087343-LVRH1MP-200 ...
-
bioRxiv - Neuroscience 2024Quote: ... DV: -1.75) and 0.2μl AAV-hSyn-DIO-hM4D(Gi)-mCherry (44362-AAV5, Addgene, 7×10¹² vg/mL) was injected at a rate of 0.05μl/min ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... To label mitochondria and ER we used the mCherry-Mito-7 (a gift from Michael Davidson - Addgene plasmid # 55102;http://n2t.net/addgene:55102;RRID:Addgene_55102 ...