-
No products found
because this supplier's products are not listed.
Joel D. Pearson, et al.,
bioRxiv - Microbiology 2020
Quote:
The 2019-nCoV TaqMan RT-PCR Kit from Norgen Biotek and 2019-nCoV ...
-
No products found
because this supplier's products are not listed.
Takenori Kanai, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The RT-PCR products were separated on 2% agarose gel (NuSieve; FMC, Rockland, ME, USA) and visualized by Syber Green (Takara) ...
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40015, SKU# B40015-500rxns,
500rxns, $267.00
Ask
Andrea Cerquone Perpetuini, et al.,
bioRxiv - Cell Biology 2019
Quote:
... or mifepristone (RU-486, Selleck Chemicals, #S2606) dissolved in DMSO ...
-
No products found
because this supplier's products are not listed.
RA Seaborne, et al.,
bioRxiv - Physiology 2019
Quote:
... UBR5 PCR primers and pyrosequencing primers were purchased from EpigenDX (Hopkinton, MA, USA), rat assay no ...
-
No products found
because this supplier's products are not listed.
Aidan E Gilchrist, et al.,
bioRxiv - Bioengineering 2019
Quote:
... and prepped for RT-PCR using PIPETMAX (Gilson, Middleton, WI). The CT of each gene/sample was performed in duplicate ...
-
No products found
because this supplier's products are not listed.
Bryce W. Duncan, et al.,
bioRxiv - Neuroscience 2021
Quote:
... To inhibit PAK1-3 cells were preincubated with the small molecule pyridopyrimidinone inhibitor FRAX 486 (Tocris, Inc.) [26] at 500 nM in 0.01% DMSO for 30 min ...
-
No products found
because this supplier's products are not listed.
Andrea S. Baez-Gonzalez, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Quantitative RT-PCR (qPCR) was performed with FastSYBR mixture (CoWin Biosciences) on the AriaMx Real-Time PCR System (Agilent Technologies ...
-
No products found
because this supplier's products are not listed.
Ya-Lin Lu, et al.,
bioRxiv - Neuroscience 2020
Quote:
AGO HITS-CLIP was performed on cells after 2 weeks into reprogramming of miR-NS or miR-9/9*-124-expressing neonatal fibroblasts (ScienCell, 2310) at day 14 and day 21 ...
-
No products found
because this supplier's products are not listed.
Chiara Cassioli, et al.,
bioRxiv - Immunology 2020
Quote:
... and analyzed by RT-qPCR on 96-well optical PCR plates (Sarstedt) using the SsoFast™ EvaGreen® Supermix (Bio-Rad ...
-
No products found
because this supplier's products are not listed.
Juhee Son, et al.,
bioRxiv - Microbiology 2021
Quote:
... All piglets were confirmed negative for TGEV by RT-PCR and ELISA (IDEXX, USA). The pigs were randomly separated into three groups ...
-
No products found
because this supplier's products are not listed.
Jingyao Li, et al.,
bioRxiv - Genomics 2021
Quote:
... 10 nl of 1 uM barcoded DRUG-seq RT primers were then dispensed into each well using an Echo 555 Liquid Handler (Labcyte). Plates were sealed (BioRad ...
-
No products found
because this supplier's products are not listed.
Suman Khan, et al.,
bioRxiv - Microbiology 2023
Quote:
... 10.8% Drug Like Set (Enamine, Ukraine), 26.8% DiversetCL (Chembridge ...
-
No products found
because this supplier's products are not listed.
Miguel Alejandro Lopez-Ramirez, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Neutravidin Bead sets for were from Spherotech, Inc. ...
-
No products found
because this supplier's products are not listed.
Deborah D. Chin, et al.,
bioRxiv - Bioengineering 2020
Quote:
... Thiolated miR-145 was conjugated to DSPE-PEG(2000)-malemide (Avanti Polar Lipids, Alabaster, AL) via a thioether bond by adding a 10% molar excess of lipid to reduced thiolated miR in DEPC-treated water ...
-
No products found
because this supplier's products are not listed.
E Chuntharpursat-Bon, et al.,
bioRxiv - Cell Biology 2019
Quote:
... perfusion set (yellow/green) and fluidics unit (Ibidi). Cells were exposed to shear stress of 10 dyn.cm−2 for 24 hr ...
-
No products found
because this supplier's products are not listed.
Yasmina Curto, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Different sets of C57BL/6 mice (Charles River) were used for the extracellular recordings (P90 ...
-
No products found
because this supplier's products are not listed.
Cameron C. Gardner, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... using gene-specific primers (Table 2) from lung genomic DNA and then gel purified using the Gel/PCR DNA Fragments Extraction Kit (IBI Scientific). The gel purified DNA fragments were cloned into the pMiniT 2.0 vector ...
-
No products found
because this supplier's products are not listed.
Vilde Leipart, et al.,
bioRxiv - Biochemistry 2022
Quote:
... We made three sets of blank samples: buffer blank and two sets with SUMO-1 (human, His-tag, Enzo Life Sciences). One collection of SUMO-1 samples were incubated with 25uM ZnCl2 at 4 °C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Jean-Paul Armache, et al.,
bioRxiv - Biophysics 2019
Quote:
... DNA labeled at two locations for ensemble FRET experiments was prepared by large scale PCR of two DNA templates using labeled primers (IBA Life Sciences). 120μg of each DNA template was digested with AflIII at 37°C overnight and purified by native PAGE ...
-
No products found
because this supplier's products are not listed.
Adrien Chauvier, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... 10 µM ApU dinucleotide primer (Trilink), and 50 nM DNA template ...
-
No products found
because this supplier's products are not listed.
Wakana Sato, et al.,
bioRxiv - Synthetic Biology 2022
Quote:
... The plate reader was set to a photomultiplier tube (PMT) “medium” and 6 reads per well ...
-
No products found
because this supplier's products are not listed.
Mohammad Nematullah, et al.,
bioRxiv - Immunology 2023
Quote:
... and fixed and permeabilized using Fixation/Permeabilization buffer set (Proteintech), as directed by the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Ciara G. Doran, et al.,
bioRxiv - Immunology 2021
Quote:
... and then were set into Incucyte Live-Cell Analysis Systems (Sartorius). The first scan was made at 1h after the treatment ...
-
No products found
because this supplier's products are not listed.
Abeer Al-Zubaidi, et al.,
bioRxiv - Microbiology 2021
Quote:
... All assays were set up in 96 well plates (Greiner Bio-One) in a total volume of 100μL where 50μL of the diluted culture was added to 50μL of two-fold serially diluted antibiotics in Middlebrook 7H9 media ...
-
No products found
because this supplier's products are not listed.
M.A.M. Vis, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The set-up composed of a peristaltic pump (model P-70, Harvard Apparatus, Holliston, USA) and five in-house made polysulfone medium reservoirs ...
-
No products found
because this supplier's products are not listed.
Kylee Morrison, et al.,
bioRxiv - Microbiology 2019
Quote:
... A dsDNA fragment encompassing a 250 bp hybrid pri-miR-122/K6-5p sequence and flanking XhoI and NotI cloning sites was ordered from Epoch Life Science (Missouri City, TX), cloned in the intermediate vector pBSK ...
-
No products found
because this supplier's products are not listed.
Katharina Heinzelmann, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Cells were set on air liquid interface (ALI) (=day 0) using PneumaCult ALI media (STEMCELL Technologies) and cultured until day 21 or 28 with media change every other day ...
-
No products found
because this supplier's products are not listed.
Benjamin C. Creekmore, et al.,
bioRxiv - Pathology 2023
Quote:
... Tissue was cut with the vibratome set to 100 μm sections using sapphire blade (Ted Pella, Redding, CA, USA), maximum amplitude ...
-
No products found
because this supplier's products are not listed.
Line Jensen Ostenfeld, et al.,
bioRxiv - Microbiology 2022
Quote:
45μl PCR product was purified with Gene Clean Turbo for PCR kit (MP Biomedicals) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Alexander F. Schubert, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and fluorescence polarization was monitored at room temperature on a Clariostar plate reader equipped with a 540/590 nm filter set (BMG Labtech). Ub/Ubl substrate alone and KG(TAMRA ...
-
No products found
because this supplier's products are not listed.
Ron Baik, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and PCR-based assays (Bulldog Bio).
-
No products found
because this supplier's products are not listed.
Abhirup Shaw, et al.,
bioRxiv - Cell Biology 2021
Quote:
... The absence of mycoplasma was confirmed by PCR analysis (PCR Mycoplasma Test Kit I/C, Promocell, Heidelberg, Germany). Cells were differentiated following a reported white adipogenic differentiation protocol ...
-
No products found
because this supplier's products are not listed.
Kati J. Ernst, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... and PCR Clean wipes (Minerva Biolabs 15-2001) prior to sample processing ...
-
No products found
because this supplier's products are not listed.
Dorota D. Klysz, et al.,
bioRxiv - Immunology 2023
Quote:
... and 2ul of each barcoded PCR primer (ApexBio, K1058). 14 PCR cycles were run for each sample ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Reverse transcription quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR MasterMix (Alfagene) according to the manufacturer’s instructions and using primers forward and reverse at 0,25 μM (final concentration ...
-
No products found
because this supplier's products are not listed.
Leemon Nikhila, et al.,
bioRxiv - Cell Biology 2023
Quote:
... SYBR Green-Labelled PCR primers for all targeted genes were purchased from G-Biosciences made in (St ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Debajeet Ghosh, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Using a capillary set (Nanotemper technologies), the samples were loaded one by one into the machine ...
-
No products found
because this supplier's products are not listed.
Regina Tkach, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Oligonucleotide primers provided by Lumiprobe RUS Ltd are listed in Table S1 SD.
-
No products found
because this supplier's products are not listed.
Galen J. Correy, et al.,
bioRxiv - Biochemistry 2022
Quote:
... MicroRT tubing (Mitegen, RT-T1) with 5 μl of reservoir in the end was placed over the crystals to prevent dehydration ...
-
No products found
because this supplier's products are not listed.
Meg A. Younger, et al.,
bioRxiv - Neuroscience 2022
Quote:
... a 1 mL Dounce tissue grinder and pestle set (Wheaton 357538) that had been autoclaved at 121°C for 4 hr the previous day was pre-wetted with homogenization buffer ...
-
No products found
because this supplier's products are not listed.
Pedro Sampaio, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... a set of two motorized axis manipulators (MPC-385-2, Sutter Instruments) placed on both sides of a culture dish for moving pipettes to the desired positions ...
-
No products found
Sumit Handa, et al.,
bioRxiv - Biochemistry 2020
Quote:
Reverse transcription reactions with Moloney Murine Leukemia Virus (MMLV) RT (BioBharati Life Sciences Pvt. Ltd) and HIV RT (Worthington Biochemical) were carried out according to the manufacturer’s directions using primer P5 (Table S1) ...
-
No products found
because this supplier's products are not listed.
Konstantinos Stamatiou, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3D data sets were acquired using either 1) a cooled CCD camera (CH350; Photometrics) on a wide-field microscope (DeltaVision Spectris ...
-
No products found
because this supplier's products are not listed.
Dapeng Chen, et al.,
bioRxiv - Biochemistry 2021
Quote:
... The 10 µm pore-size filter discs and the column sets were acquired commercially (Boca Scientific, Dedham, MA). Escherichia coli bacteriophage MS2 was purchased from ATCC (Manassas ...
-
No products found
because this supplier's products are not listed.
Yun Huang, et al.,
bioRxiv - Biophysics 2023
Quote:
... The temperature was then set to 30 °C and protein expression was induced by adding 0.2 % arabinose (Goldbio). Cells were grown for additional 16 hours ...
-
No products found
because this supplier's products are not listed.
Satoshi Watanabe, et al.,
bioRxiv - Neuroscience 2020
Quote:
... The intensity was set to evoke about half-maximal EPSC (400 µA for 0M, 300 µA for 3M and 6M). EPSCs and IPSCs were recorded at a holding potential of -65 mV and 0 mV ...
-
No products found
because this supplier's products are not listed.
Simon Amiard, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and chromatin sonicated using the Diagenode Bioruptor (set to high intensity, 3 times 7 cyles (30sec ON / 30 sec OFF) or the S220 Focused-ultrasonicator (Covaris) for 20 min at peak power 110 W ...
-
No products found
because this supplier's products are not listed.
Christopher B. Mahony, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... blocked in 4% FBS for 20 mins at RT and stained with H2A.XS139ph (GeneTex, GTX127342) (diluted 1:1000 in 3% FCS/PBS ...
-
No products found
because this supplier's products are not listed.
Dennis J. Weingarten, et al.,
bioRxiv - Neuroscience 2021
Quote:
... then in primary antibody for 2 h at RT (rabbit anti-Syt3, 1:3000, Synaptic Systems 105133 ...