-
No products found
because this supplier's products are not listed.
Jessica M. Salmon, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... separate PCRs were set up to generate the CITE-seq ADT library (SI-PCR and RPI-x primers) and the HTO library (SI-PCR and D7xx_s).
-
No products found
because this supplier's products are not listed.
Yvonne Giesecke, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Quantitative real-time human-specific primer sets for CyberGreen PCR amplifications were obtained from TIB Molbiol (Berlin, Germany). Primer sequences were:
-
No products found
because this supplier's products are not listed.
Beatriz Castejon-Vega, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... the GeneSwitch (GS) system was used in conjunction with fluctuating concentrations of RU-486 (Abcam, ab120356). Flies used in all experiments were collected within a 48-hour period post-eclosion ...
-
No products found
because this supplier's products are not listed.
Corinne A. Tovey, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were synthesised either by PCR using two overlapping primers or by GENEWIZ. They were inserted into the linear backbone by HiFi Assembly (NEB) ...
-
No products found
because this supplier's products are not listed.
Boshi Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... human CXCL1/GROα duo-set or CCL5 duo-set or IGFBP3 duo-set (R&D Systems) were used to detect the concentrations of CXCL1 or CCL5 or IGFBP3 in the plasma following manufacturer’s instructions.
-
The Mouse Direct PCR Kit provides a fast preparation and PCR amplIFication that is specIFically...
Cat# B40013, SKU# B40013-200rxns,
200rxns, $127.00
Ask
Bo Zhang, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... Then the cDNA was subjected to quantitative RT-PCR (qRT-PCR) using the SYBR green assay with 2× SYBR green qPCR master mix (Bimake). Thermal profile was 95 °C for 5 min and 40 cycles of 95 °C for 15 sec and 60 °C for 20 sec ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... BTLA (BTA-H5255; Acrobiosystems), ICOS (ICS-H5258 ...
-
No products found
because this supplier's products are not listed.
Ece Yildiz, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Hoechst signal (361/486 nm) was quantified by SpectraMax iD3 microplate reader (Molecular Devices).
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... Alexa Fluor 488 conjugated donkey anti-chicken IgY (Jackson Immunoresearch, 1:1000 dilution, 703-486-155), Alexa Fluor 647 conjugated donkey anti-mouse IgG (Jackson Immunoresearch ...
-
No products found
because this supplier's products are not listed.
Ljiljana Mihajlovic, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... we performed a DNA damage repair reaction followed by exonuclease treatment (ExoIII and ExoVII) using the SMRTbell DNA Damage Repair Kit (PacBio # 100-486-900) according manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Nazahiyah Ahmad Rodzli, et al.,
bioRxiv - Biophysics 2019
Quote:
... Crystallisation trials were set up using a Mosquito (TTP Labtech) liquid handling robot ...
-
No products found
because this supplier's products are not listed.
Abigail A. Mornement, et al.,
bioRxiv - Physiology 2023
Quote:
Mifepristone or RU-486 (Cayman chemicals, 10006317), hereafter referred to as RU ...
-
No products found
because this supplier's products are not listed.
Kevin Lin, et al.,
bioRxiv - Systems Biology 2023
Quote:
... and the Supplementary Primer Sets (Cellecta #LNGS-120-SP) to amplify the sgRNA and append Illumina sequencing adapters and index barcodes for each replicate sample ...
-
No products found
because this supplier's products are not listed.
Taihei Fujimori, et al.,
bioRxiv - Genetics 2023
Quote:
... or CUTANA™ CUT&RUN Library Prep Kit with Primer Set 1 (14-1001, EpiCypher), and library concentrations were quantified with the Qubit 1 X dsDNA HS Assay Kit (Q33231 ...
-
No products found
because this supplier's products are not listed.
Haowen Qiao, et al.,
bioRxiv - Neuroscience 2022
Quote:
... RT-PCR was performed using SYBR Green Real-time PCR Master Mix (RK21203, ABclonal Technology) under the following reaction conditions (35 cycles) ...
-
No products found
because this supplier's products are not listed.
Debatosh Das, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Real-time RT-PCR was performed with the qPCR GreenMaster high ROX mix (Jena Bioscience, Germany) and primers shown in Table S1 ...
-
No products found
because this supplier's products are not listed.
Ana Cláudia Raposo, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... Reverse Transcriptase quantitative PCR (RT-qPCR) was performed using NZYSpeedy qPCR Green Master Mix ROX (#MB22302, NZYTech) or NZYSpeedy qPCR Green Master Mix ROX Plus (#MB22202 ...
-
No products found
because this supplier's products are not listed.
Nishit Goradia, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and was directly used for quantitative PCR with SimpleChIP human CDKN1A promoter primers (Cell Signaling Technology, MA, US). ChIP-qPCR data were normalized to input DNA and presented as percentage of input ...
-
No products found
because this supplier's products are not listed.
Pablo Canales-Herrerias, et al.,
bioRxiv - Immunology 2023
Quote:
ELISA was performed using Mouse IgA ELISA Quantitation Set or Mouse IgG ELISA Quantitation Set (Bethyl Laboratories) according to the manufacturer’s protocol with minor modifications ...
-
No products found
because this supplier's products are not listed.
Mark A. Rutherford, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Electrophoresis of 10 µl of RT-PCR products was performed using 3% agarose (SeaKem LE Agarose by Lonza) with molecular ladder gel containing 0.5 µg/ml ethidium bromide in x0.5 tris-acetate-ethylenediaminetetraacetic acid (TAE ...
-
No products found
because this supplier's products are not listed.
Soumitra Ghosh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... ATAC-seq library preparation involved PCR amplification of the purified DNA fragments using Diagenode primer indices (Diagenode, Cat# C01011034). Amplification cycles were adjusted and libraries were purified using AMPure beads ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Schott, et al.,
bioRxiv - Bioengineering 2024
Quote:
... samples were homogenized with TRIzol RT Reagent (Molecular Research Center, RT 111) and pulverized by mechanical compression ...
-
No products found
because this supplier's products are not listed.
Jan Felix, et al.,
bioRxiv - Biochemistry 2019
Quote:
Crystallization trials were set up manually in a sitting drop vapour diffusion set-up using 24-well sitting drop plates (Hampton research) with drop volumes of 1 µl (0.5 µl protein solution + 0.5 µl reservoir solution) ...
-
No products found
because this supplier's products are not listed.
Antonio Galindo, et al.,
bioRxiv - Cell Biology 2020
Quote:
... were set up in 96-well black-bottomed plates (Corning), and fluorescence decay was measured at 30°C.
-
No products found
because this supplier's products are not listed.
Alexander P. Ligocki, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and Z6040 embedding primer (EMS, Hatfield, PA) in increments of 3:1 ...
-
No products found
because this supplier's products are not listed.
Raza Ali Naqvi, Araceli Valverde, Afsar Naqvi,
bioRxiv - Immunology 2023
Quote:
... Gene expression was examined using PCR array plate containing 88 primer sets directed against human NF-κB pathway genes and 8 housekeeping primer sets (Real Time Primers, LLC Elkins Park, PA). Briefly ...
-
No products found
because this supplier's products are not listed.
Weirong Kang, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... qRT-PCR primers were from Sino Biological (Wayne, PA) or Genetimes ExCell (Hong Kong) ...
-
No products found
because this supplier's products are not listed.
Enxhi Shaba, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The HEK293T cells (mycoplasma-free, verified by N-GARDE Mycoplasma PCR reagent set, Euroclone) were maintained in Dulbecco’s modified Eagle’s Medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Brandon T. Sinn, et al.,
bioRxiv - Genomics 2021
Quote:
... reactions were set up in 10 μl volumes with: 5 μl 2×Apex PCR Master Mix (Genesee Scientific ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jean Jacques Walker, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Phymep) set on a micro-syringe pump injector (UMP3 UltraMicroPump, WPI), 6-OHDA rats received 2.3 μL bilateral injections of 6-OHDA hydrobromide (6 μg combined with ascorbic acid dissolved in 2.3 μL sterile 0.9% NaCl ...
-
No products found
because this supplier's products are not listed.
Courtney Tindle, et al.,
bioRxiv - Immunology 2023
Quote:
... A custom primer panel was developed by Tecan Genomics ...
-
No products found
because this supplier's products are not listed.
Virginia Andrade, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3 % milk at RT and revealed by LI-COR (Biosciences).
-
No products found
because this supplier's products are not listed.
Yoichiro Harada, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... was used as a template to amplify the MPI gene by PCR using a primer set (Supplementary Table S1) and the PCR products were cloned into pMXs-Neo retroviral expression vector (RTV-011, Cell Biolabs) to yield pMXs-Neo-hMPI by using In-Fusion HD Cloning Kit (639648 ...
-
No products found
because this supplier's products are not listed.
Masayuki Hayakawa, et al.,
bioRxiv - Biophysics 2019
Quote:
... 1 μL of the PB including 3% fluorescent microbeads (ex:441, em:486, 1.0 μm, Polysciences, Inc.) was spread at the same time with the KI cells ...
-
No products found
because this supplier's products are not listed.
Cameron Moshfegh, et al.,
bioRxiv - Cell Biology 2021
Quote:
... PCR Primers were designed using PrimerSelect from the Lasergene software package (DNASTAR, USA). All primers were synthesized at Microsynth ...
-
No products found
because this supplier's products are not listed.
Alexander J. Garvin, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Clones were screened by PCR using primers that flank the SUMO4 gene using genomic DNA purified with direct PCR buffer (Viagen). Clones that displayed reduced size of SUMO4 PCR product were sequenced by Sanger sequencing to confirm disruption of the SUMO4 locus ...
-
No products found
because this supplier's products are not listed.
J. Martinez-Fabregas, et al.,
bioRxiv - Immunology 2020
Quote:
... Agencourt AMPure XP beads and PCR amplified using KAPA hot start High-Fidelity 2X PCR Master Mix and NextFlex index primers (Bioo Scientific, PerkinElmer) for 12 cycle by following thermocycler cycles ...
-
No products found
because this supplier's products are not listed.
Takenori Kanai, et al.,
bioRxiv - Cell Biology 2019
Quote:
... The RT-PCR products were separated on 2% agarose gel (NuSieve; FMC, Rockland, ME, USA) and visualized by Syber Green (Takara) ...
-
No products found
because this supplier's products are not listed.
Kutubuddin A. Molla, Justin Shih, Yinong Yang,
bioRxiv - Plant Biology 2019
Quote:
... The target loci were amplified by PCR using specific primers (Supplementary Table 1) and resulting DNA fragments were purified with PCR purification kit (Bio Basic Inc, Canada). The wsl5 and zebra3 PCR product was digested with SacI and SalI ...
-
No products found
because this supplier's products are not listed.
Sushama Telwatte, et al.,
bioRxiv - Microbiology 2021
Quote:
... The log-linear relationship between viral load measured by RT-PCR (Abbott Real Time SARS-CoV-2 assay) and RT-ddPCR was determined using GraphPad Prism (version 8.4.1).
-
No products found
because this supplier's products are not listed.
Daniele Merico, et al.,
bioRxiv - Genetics 2019
Quote:
... PCR was performed with primers P243 and P472 and separated on 2% agarose gels stained with 0.05% Redsafe (FroggaBio). See Supplementary Dataset 1 for primer sequences.
-
No products found
because this supplier's products are not listed.
Yulong Wei, et al.,
bioRxiv - Bioengineering 2021
Quote:
... a set of von Frey fibers (Stoelting Touch Test Sensory Evaluator Kit #2 to #9 ...
-
No products found
because this supplier's products are not listed.
Minae Yoshida, Dean Willis,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... with random primers (Invivogen). 2 μg of total RNA were used per construct.
-
No products found
because this supplier's products are not listed.
Veronika Mikhaylova, et al.,
bioRxiv - Genomics 2023
Quote:
... to remove primers plus one or two rounds of 0.41x HighPrep™ PCR Clean-up beads (Cat. #AC-60050; MagBio Genomics®) for 13 kb SCN10A amplicons ...
-
No products found
because this supplier's products are not listed.
Luca Barberi, et al.,
bioRxiv - Biophysics 2020
Quote:
... a Quantum GIF energy filter (Gatan, slit width set to 20eV) and a Volta Phase Plate (VPP) ...
-
No products found
because this supplier's products are not listed.
Ryan Scott Wilkins, et al.,
bioRxiv - Biochemistry 2024
Quote:
From a set of four commercial crystallization screens from Molecular Dimensions multiple hits were identified for BpCM when screened at 1 mM ...
-
No products found
because this supplier's products are not listed.
Jeong-Su Park, et al.,
bioRxiv - Immunology 2022
Quote:
... and reverse-transcribed using RT-Premix (Intron Biotechnology). PCR was performed with the following primers (the respective forward and reverse pairs are indicated) ...
-
No products found
because this supplier's products are not listed.
Anisha P. Adke, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and left overnight to air-dry before coverslips were set using Fluoromount-G (SouthernBiotech). Representative high magnification images were collected using a Nikon A1R laser scanning confocal microscope and a 40x oil-immersion objective ...
-
No products found
because this supplier's products are not listed.
Gopal Kushawah, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... PCR products were purified using Favorprep Gel/PCR purification kit (Favorgen) columns or PCR purification kit (QIAgene ...