-
No products found
because this supplier's products are not listed.
Hisham Temmar, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The actual task performed by the monkey is to match pseudo-randomly presented targets for each finger group (IDX or MRS), as described in previous studies (16 ...
-
No products found
because this supplier's products are not listed.
Rebecca A. Rasmussen, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Molarity was calculated by normalizing data to a series of standard zinc solutions (Inorganic Ventures, Christiansburg, VA, USA).”
-
No products found
because this supplier's products are not listed.
DW Williams, et al.,
bioRxiv - Systems Biology 2021
Quote:
... Biopsies were either placed into RPMI medium to be processed into single cell suspensions or fixed with 10% zinc formalin (American MasterTech Scientific) for histology ...
-
No products found
because this supplier's products are not listed.
Arielle L. Homayouni, et al.,
bioRxiv - Plant Biology 2024
Quote:
... sub-family C domains of ABCC10 and relatives were aligned with Lasergene MegAlign (DNASTAR) using the ClustalW default settings with the Gonnet series protein weight matrix ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
S. Hong Chan, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 5’ Gppp- cap and 5’ m7Gppp- cap are synthesized by Bio-synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Vanessa Nunes, et al.,
bioRxiv - Cell Biology 2019
Quote:
... 5]-PEG(2) (SuSoS) in 10 mM HEPES at pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Hailey Larose, et al.,
bioRxiv - Plant Biology 2022
Quote:
... 5-deoxystrigol (5DS; StrigoLab) or Oro ...
-
No products found
because this supplier's products are not listed.
Ivica Odorcic, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5 μM Aβ46 (rPeptide) resuspended in dimethyl sulfoxide (DMSO ...
-
No products found
because this supplier's products are not listed.
David E Ehrlich, David Schoppik,
bioRxiv - Neuroscience 2019
Quote:
Supplemental videos at high spatial resolution were alternatively filmed in a thinner glass tank (96/G/5 24×5×5 mm, Starna Cells, Inc.) using a Sony IMX174 CMOS chip (ace acA1920-155um ...
-
No products found
because this supplier's products are not listed.
Mark A. Skylar-Scott, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 5 μM SB431542 (BioGems, #3014193), and 100 nM LDN193189 (BioGems ...
-
No products found
because this supplier's products are not listed.
RAG da Silva, et al.,
bioRxiv - Microbiology 2019
Quote:
... ET-5 purchased from LGC Standards and L91543 serogroup C:2aP1.2 ...
-
No products found
because this supplier's products are not listed.
Masaharu Somiya, Shun’ichi Kuroda,
bioRxiv - Cell Biology 2021
Quote:
... Transporter 5 Transfection Reagent (Polyscience, Inc.), or branched 25-kDa polyethyleneimine (PEI ...
-
No products found
because this supplier's products are not listed.
Jing-Yu Lin, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 250 nM 5-Iodotubercidin (Adooq Bioscience), 50 ng/ml FGF10 (PeproTech) ...
-
No products found
because this supplier's products are not listed.
Xiaohui Zhao, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 5-fluorotryptamine hydrochloride (AstaTech, Catalog #52030), 6-fluorotryptamine (AstaTech ...
-
No products found
because this supplier's products are not listed.
Peter Kindgren, Maxim Ivanov, Sebastian Marquardt,
bioRxiv - Genomics 2019
Quote:
... or 5 μM Herboxidiene (Focus Biomolecules) containing plates for 6 or 24 hours ...
-
No products found
because this supplier's products are not listed.
Rahul Bhattacharjee, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Haploid integrants were then isolated based on resistance to 5-fluorourotic acid (5-FOA) (United States Biological; F5050) and integration of the cdc15 mutations was verified by growth on selective media followed by PCR and DNA sequencing ...
-
No products found
because this supplier's products are not listed.
Aleksandra A. Petelski, et al.,
bioRxiv - Bioengineering 2021
Quote:
... myFuge 5 (MTC Bio; cat. no: C2595).
-
No products found
because this supplier's products are not listed.
Naoki Hayashi, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... tetracycline hydrochloride (IBI Scientific, 5 μg/mL), Polymyxin B sulfate (Merck Millipore ...
-
No products found
because this supplier's products are not listed.
Lukas Spiller, et al.,
bioRxiv - Immunology 2023
Quote:
... 5 nmol CpG (TIB MOLBIOL, Berlin, Germany), and an equal volume of Incomplete Freund’s adjuvant (IFA ...
-
No products found
because this supplier's products are not listed.
Shuai Qi, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 5 ul 2×Taq PCR mix (TIANGEN, China), 0.5 ul each primer (trnL and trnF (Taberlet et al. ...
-
No products found
because this supplier's products are not listed.
Mami Yasukawa, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... and 5% BriClone Hybridoma Cloning Medium (QED Bioscience). One hundred units/ml penicillin ...
-
DA agonist
Sold for research purposes only.
Cat# 1026.0, SKU# 1026-100 mg,
Inquire
Ask
M. Joaquina Delás, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... 5 µM CHIR99021 (Axon Medchem, Cat. No. 1386), 10 µM SB-431542 (Tocris ...
-
No products found
because this supplier's products are not listed.
Vinita Bharat, et al.,
bioRxiv - Cell Biology 2022
Quote:
MitoNeoD at 5 μM (563761, MedKoo Biosciences Inc.), RPA at 5 μM (ME043.1 ...
-
No products found
because this supplier's products are not listed.
Maria L. Sorkin, et al.,
bioRxiv - Plant Biology 2022
Quote:
... and 5 μM MG132 (Peptides International, Louisville, KY)) and sonicated using a duty cycle of 20 s (2 s on ...
-
No products found
because this supplier's products are not listed.
Rouhollah Habibey, et al.,
bioRxiv - Bioengineering 2023
Quote:
... SU- 8 5 and SU-8 50 (MicroChem) were subsequently spin-coated on the wafer at different heights (5 µm for microchannels and 100 µm for microwells ...
-
No products found
because this supplier's products are not listed.
Paulus Mrass, et al.,
bioRxiv - Immunology 2022
Quote:
... We used the following antibodies: H3N2 virion antibody (ViroStat, Cat#: 1317); anti-mouse CD107A ...
-
No products found
because this supplier's products are not listed.
Marvin Thielert, et al.,
bioRxiv - Systems Biology 2022
Quote:
... Lys-N (ImmunoPrecise Antibodies) was added to the lysate in a 1:100 (enzyme/protein ...
-
No products found
because this supplier's products are not listed.
Steven A. Erickson, et al.,
bioRxiv - Immunology 2021
Quote:
... 5-7 IU of PMSG (Millipore #367222/BioVendor #RP1782721000) was injected (IP ...
-
No products found
because this supplier's products are not listed.
Yongchan Lee, et al.,
bioRxiv - Biochemistry 2021
Quote:
... and L-[3H]alanine (5 Ci/mol; Moravek Biochemicals)) were measured for 3 min in Na+-free HBSS pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Valentin Mitterer, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Growth phenotypes of the mutant alleles were analysed on plates containing 1 g/l 5-fluoroorotic acid (5-FOA) (Apollo Scientific, Cat# PC4054) to select for cells that have lost the wild-type SPB4-containing URA3 plasmid ...
-
No products found
because this supplier's products are not listed.
Maria Kuzikov, et al.,
bioRxiv - Molecular Biology 2023
Quote:
5 µl/ 100 nM of USP7/USP14 (BPS bioscience, #80364) were added to assay plates containing the compounds ...
-
No products found
because this supplier's products are not listed.
Stephan Tetenborg, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 1 µg of DNA were transfected using 5 µl Geneporter2 (Genlantis) or 1.5 µl Lipofectamine 2000 (Thermo Fisher).
-
No products found
because this supplier's products are not listed.
Marie Ouarné, et al.,
bioRxiv - Cell Biology 2023
Quote:
... a stock of 50mg 5-ethynyl-2-deoxyuridine (EdU) (Alfagene, A10044) was diluted in 5mL of PBS to make a working solution (10mg/mL) ...
-
No products found
because this supplier's products are not listed.
Avais M. Daulat, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CLASP2 antibody was obtained from Absea Biotechnology ltd ...
-
No products found
because this supplier's products are not listed.
Alessandro Gori, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The detector antibody (biotinylated CD9, CD63, CD81 antibodies by Ancell or anti-band 3 from Santa Cruz) solutions (0.3 µg/ml ...
-
No products found
because this supplier's products are not listed.
Sumit J. Bandekar, et al.,
bioRxiv - Biochemistry 2024
Quote:
... ADGRL3 + GFP and TEN2 + dsRed and 5 μL LipoD293T (SL100668; SignaGen Laboratories). Two days after transfection ...
-
Cat# F101,
USD $80.00/EA
Ask
Shaowen White, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 1:500 mouse anti-VP5 antibody (Biodesign), or 1:250 chicken anti-UL34 antiserum (Reynolds et al. ...
-
No products found
because this supplier's products are not listed.
Jie Su, Naoko Toyofuku, Takuro Nakagawa,
bioRxiv - Genomics 2021
Quote:
... After adding 5 to 10 µl Zymolyase 20T (Seikagaku, Tokyo, Japan, 25 mg/ml) and 5 to 10 µl lyzing enzyme (Sigma ...
-
No products found
because this supplier's products are not listed.
DT Dinh, et al.,
bioRxiv - Molecular Biology 2021
Quote:
CBAF1 female mice were stimulated with 5 IU eCG (Lee BioSolutions, Maryland Heights, USA) and culled at 44 hours post-eCG ...
-
No products found
because this supplier's products are not listed.
Marcus Griffiths, et al.,
bioRxiv - Plant Biology 2023
Quote:
Modified Hoagland’s solution imaging gels solidified with 5% Gelzan™ (Caisson Labs, UT, USA) were prepared for the root imaging experiments ...
-
No products found
because this supplier's products are not listed.
Mihwa Choi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... including antibodies against NET (Mab Technologies, 1:1000 dilution), cFos (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
,
bioRxiv - Microbiology 2019
Quote:
... brain and lungs were collected and placed in labeled 5 ml tubes (CELLTREAT, Pepperell, MA) containing 2 ml of HBSS with no dye on ice ...
-
No products found
because this supplier's products are not listed.
Temitayo T. Bamgbose, et al.,
bioRxiv - Immunology 2023
Quote:
... exposed to UV radiation for 5 mins in the UV Clave™ Ultraviolet Chamber (Benchmark Scientific). PBS containing Jurkat cells was collected ...
-
No products found
because this supplier's products are not listed.
Yasmine Rais, Andrei P. Drabovich,
bioRxiv - Biochemistry 2024
Quote:
... Supernatant (5 ml) was added to the 0.5-1 kDa molecular cut-off membrane (Spectrum Laboratories) and dialyzed in 1 mM ammonium bicarbonate with two buffer exchanges for 24 hours at 4° C ...
-
No products found
because this supplier's products are not listed.
Han-Wei Shih, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Alexa 647-conjugated anti-CWP1 antibody (Waterborne, New Orleans, LA) was used at 1:2,000 ...
-
No products found
because this supplier's products are not listed.
Chiara E. Geyer, et al.,
bioRxiv - Immunology 2022
Quote:
... IL-6 concentration was determined using antibody pairs from U-CyTech Biosciences (Human IL-6 ELISA ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ludmila Recoules, et al.,
bioRxiv - Genomics 2021
Quote:
... Rabbit anti- mH2A1.1 antibody was generated according to immunization protocol from Agro-Bio - La fierté Saint-Aubin – France ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
... Liver slides were stained with goat-anti-hFIX antibody (1:2000, Affinity Biologicals, GAFIX-AP). Subsequently ...