-
No products found
because this supplier's products are not listed.
Arshed Nazmi, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 4.2 µl RNase-free water) was added to 10 µl RNA for each sample in a nuclease-free PCR tube (Greiner Bio-One, Monroe, NC). No reverse transcriptase and no RNA controls were also assessed by PCR ...
-
No products found
because this supplier's products are not listed.
Hannah E. Gilbonio, et al.,
bioRxiv - Genetics 2023
Quote:
... We washed slides twice for 5 minutes in RNase-free 1X PBS and marked the sample perimeter of each slide with an ImmEdge pen (Vector Laboratories #H-4000) in between both washes ...
-
No products found
because this supplier's products are not listed.
Roshali T. de Silva, et al.,
bioRxiv - Microbiology 2020
Quote:
... Water was obtained from an ultrapure (18.2 MOhm.cm) water purification system (Sartorius).
-
No products found
because this supplier's products are not listed.
Muhammad Zahoor, et al.,
bioRxiv - Cell Biology 2023
Quote:
... RNase-Free Pellet Pestles (Thomas Scientific) for 15 second with a break every 5 second ...
-
No products found
because this supplier's products are not listed.
Xiaofei Wang, et al.,
bioRxiv - Immunology 2022
Quote:
... Catch buffer: to 1 ml of RNAase-free water (Tiangen Biotech), add 40 µl Rnasin (NEB ...
-
No products found
because this supplier's products are not listed.
Rick Berentsen, et al.,
bioRxiv - Plant Biology 2024
Quote:
... with on-column DNAse treatment with an RNase-free DNase I Set (Omega BioTek, USA) and converted to cDNA with a SuperScript IV First-Strand Synthesis System (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
M.H. Kaufman, J. Torgeson, J. C. Stegen,
bioRxiv - Biochemistry 2023
Quote:
... Disks for 50 ml RNase-free plastic tubes (part number 28-106, Genesee Scientific, San Diego Ca, USA) were cut to 28.8mm dia ...
-
No products found
because this supplier's products are not listed.
Rachel E. Rigby, et al.,
bioRxiv - Immunology 2023
Quote:
... BSA/0.01% (v/v) Tween-20 in cold RNase-free PBS + 10 μl Human TruStain FcX blocking solution (#422301, BioLegend)) and incubated for 10 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Carola Venturini, et al.,
bioRxiv - Microbiology 2019
Quote:
... the precipitates were allowed to dry and then resuspended in 100 µL of DNase-free water (Lonza, Rockland, ME, USA) and kept at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
Jun Inamo, et al.,
bioRxiv - Genetics 2022
Quote:
... Total RNA preparation (100 μg) was added to 100 μL nuclease-free water and poly-A selected using NEXTflex Poly(A) Beads (BIOO Scientific) according to the manufacturer’s instructions and stored at −80°C ...
-
No products found
because this supplier's products are not listed.
Christin Krause, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Mice were maintained on a 12-h light-dark cycle with free access to water and standard chow diet (Altromin, #1314) or 58% high fat diet (HFD) (Research Diets, D12331). For the weight cycling study ...
-
No products found
because this supplier's products are not listed.
Rovingaile Kriska Ponce, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... We subsequently treated with RNAse (Cell Signaling) and stained with propidium iodide (PI ...
-
No products found
because this supplier's products are not listed.
Matthäus Mittasch, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Protein-Free (Expression Systems), supplemented with Fetal Bovine Serum (2% final concentration).
-
No products found
because this supplier's products are not listed.
Anatoly Urisman, et al.,
bioRxiv - Cancer Biology 2019
Quote:
SRM was performed on Waters nanoAcquity UPLC system (Waters) online with AB Sciex Qtrap 5500 mass spectrometer (AB Sciex). Digested peptide samples were loaded at 0.5 µg per injection and separated using two-buffer reverse phase chromatography (Buffer A = 0.1% formic acid in water ...
-
No products found
because this supplier's products are not listed.
Johanna Kaufmann, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... morphine (Hameln 03763738, in water), fentanyl (B. Braun 06900650, in water) or PMA (Tocris 1201, in dimethyl sulfoxide (DMSO)) ...
-
No products found
because this supplier's products are not listed.
Narendrakumar M. Chaudhari, et al.,
bioRxiv - Microbiology 2023
Quote:
... Filtration of soil seepage water and vadose zone seepage water samples was accomplished using 0.1 and 0.2 µm membrane filters (Supor®, Pall), respectively ...
-
No products found
because this supplier's products are not listed.
Eider Valle-Encinas, et al.,
bioRxiv - Cell Biology 2021
Quote:
Recombinant mouse Wnt9b (carrier free) and Rspo3 (carrier free) was purchased from R&D systems. Wnt9b (25 μg ...
-
Protease Inhibitor Cocktail comprehensively protects proteins from degradation by a variety of...
Cat# B14001, SKU# B14001-1 mL,
1 mL, $37.00
Ask
Shanice S. Webster, et al.,
bioRxiv - Microbiology 2021
Quote:
... EDTA-free protease inhibitors cocktail (BImake) and 10U/mL benzonase nuclease (Millipore ...
-
No products found
because this supplier's products are not listed.
Elizabeth M. Sefton, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... rinsed in water and mounted with Fluoromount-G (Southern Biotech). Primary antibodies are listed in supplemental Table 1 ...
-
No products found
because this supplier's products are not listed.
Alexa Brown, Franz R. Villaruel, Nadia Chaudhri,
bioRxiv - Neuroscience 2022
Quote:
... with unrestricted access to water and food (Agribands, Charles River). Each cage contained a nylabone toy (Nylabones ...
-
No products found
because this supplier's products are not listed.
Jürgen Tuvikene, et al.,
bioRxiv - Neuroscience 2020
Quote:
... as a vehicle control in fresh serum-free and antibiotics-free DMEM (DMEM with high glucose, PAN Biotech).
-
No products found
because this supplier's products are not listed.
Josephine Volovetz, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... fixed in 4% methanol-free formaldehyde (Polysciences) in phosphate buffer ...
-
No products found
because this supplier's products are not listed.
Ryan T. Stott, Oleg Kritsky, Li-Huei Tsai,
bioRxiv - Neuroscience 2021
Quote:
Fixed brain nuclei (see ‘Tissue Homogenization’) were resuspended in 1mL 0.5% BSA in PBS (IgG-Free, Protease-Free; Jackson ImmunoResearch). Nuclei were stained in Eppendorf tubes with the relevant antibodies rocking for 30-60 minutes at 4°C ...
-
No products found
because this supplier's products are not listed.
Charles Capdeville, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Medium in the lower chamber was either serum-free medium or serum-free medium supplemented with 20 ng/ml HGF (PeproTech, 100-39). Transwell migration was allowed for 18 hours ...
-
No products found
because this supplier's products are not listed.
Motoko Nakayama, et al.,
bioRxiv - Genomics 2021
Quote:
... and Nuclease Free Water (ABI) were used for negative control ...
-
No products found
because this supplier's products are not listed.
Li Li, Isana Veksler-Lublinsky, Anna Y. Zinovyeva,
bioRxiv - Genetics 2019
Quote:
... and RNAse free Rhino beads (MIDSCI) and homogenized using a Bullet blender (MIDSCI ...
-
No products found
because this supplier's products are not listed.
Ashraf Ul Kabir, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... the Zbtb46 ORF sequence “ATGAACAACCGAAAGGAAGATATGGAAATCACTTCTCACTACCGGCATCTGCTTC GAGAGCTCAATGAGCAGAGGCAGCACGGAGTCCTCTGTGATGCGTGCGTCGTGG TGGAGGGCAAGGTCTTCAAGGCACATAAGAACGTCTTGCTTGGGAGCAGCCGCTA CTTTAAGACGCTCTACTGCCAGGTACAGAAGACATCTGACCAGGCCACCGTCACT CACTTGGACATTGTTACAGCCCAGGGCTTCAAGGCCATTATTGACTTCATGTACTC CGCCCATCTGGCTCTCACTAGTAGGAATGTCATCGAGGTGATGTCAGCTGCCAGC TTCCTACAGATGACTGACATTGTGCAGGCCTGCCATGATTTCATCAAGGCTGCACT GGACATCAGCATAAAGTCAGATGCCTCCGATGAACTCTCAGAATTTGAGATTGGCA CCCCAGCCAGCAACAGTACAGAGGCGTTGATCTCAGCTGTGATGGCTGGAAGGAG TATCTCCCCATGGTTGGCTCGGAGAACAAGTCCTGCCAATTCTTCTGGAGACTCTG CCATTGCCAGCTGTCATGAAGGAGGAAGCAGCTATGGGAAGGAGGACCAGGAAC CCAAAGCTGATGGCCCTGATGACGTTTCTTCACAGTCTTTGTGGCCTGGAGATGTA GGCTATGGGTCTCTGCGCATCAAGGAAGAACAGATTTCACCATCACATTATGGAGG GAGTGAGCTTCCATCTTCCAAGGACACTGCAATACAGAATTCTTTATCAGAACAGG GTTCTGGGGATGGCTGGCAGCCCACAGGCCGGAGGAAGAATCGGAAAAACAAAG AGACTGTCCGACACATCACCCAGCAGGTGGAGGAGGACAGCCAGGCTGGCTCTC CAGTACCTTCATTCCTACCCACATCGGGATGGCCTTTCAGCAGCCGAGACTCAAAT GTAGACCTGACGGTCACTGAGGCCAGCAGCTTGGACAGCCGAGGCGAGAGAGCA GAGCTCTATGCTCACATCGATGAGGGCCTACTAGGAGGAGAAACCAGCTACTTGG GCCCACCCCTCACCCCAGAGAAGGAAGAAGCACTACACCAGGCTACTGCAGTGG CCAATCTTCGTGCTGCACTCATGAGTAAGAACAGTCTGCTGTCACTCAAGGCTGAC GTGCTCGGTGATGATGGCTCACTTCTGTTCGAGTACCTGCCCAAAGGTGCCCACT CACTGTCTCGTAAGTGCAAGTTCTGGTGTGTCACTGTGTCTTCCTTTGGTTTAAGCA CCTCAGTTCAGCCCTTCAGACCCTGGAGTCACTGA” was made into a modified mRNA transcript with complete substitution of pseudo-U in RNase-free water from TriLink Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Osamu Udagawa, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Each mRNA was diluted to a concentration of 25 or 100 ng/µL with RNase free water (Jena Bioscience, Jena, Germany). Each solution was loaded into a DNA injection pipette (TIP-DNA [LIC-OD1] ...
-
No products found
because this supplier's products are not listed.
Emanuela Zuccaro, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... RNase free BSA was from Gemini Bio-Products. Primary antibodies were mouse anti-□SATB2 1:250 (Abcam) ...
-
No products found
because this supplier's products are not listed.
John B. Ridenour, Rafal Donczew,
bioRxiv - Molecular Biology 2024
Quote:
... and nuclease-free water) were supplemented with dithiothreitol (DTT; GoldBio, Saint Louis, MO, USA) to maintain reducing conditions ...
-
No products found
because this supplier's products are not listed.
F. Bošković, et al.,
bioRxiv - Biophysics 2023
Quote:
... the gel was washed with nuclease-free water and incubated for 10-15 minutes in 3 × GelRed (Biotium) staining solution ...
-
No products found
because this supplier's products are not listed.
Umair W. Khan, Phillip A. Newmark,
bioRxiv - Developmental Biology 2021
Quote:
... 30% sucrose in PBS (RNAse-Free) for 20 minutes each before embedding in Tissue Freezing Medium (TFM) blocks (Ted Pella). The samples were then cryosectioned at 16 µm thickness onto PEN membrane slides (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Abigail Rogers, et al.,
bioRxiv - Plant Biology 2024
Quote:
... and nuclease-free water) and ROS production was monitored by chemiluminescence for 40 minutes in a microplate reader (Tecan Infinite M200 Pro), with higher luminescence values indicating greater ROS production ...
-
No products found
because this supplier's products are not listed.
Yang Li, et al.,
bioRxiv - Immunology 2022
Quote:
Dissected and trimmed tumors were washed in pre-cooled RNase-free H2O and transferred into MACS Tissue storage solution (Miltenyi Biotec, 130-100-008). Samples were shipped on ice overnight to Novogene ...
-
No products found
because this supplier's products are not listed.
Stefan Zdraljevic, et al.,
bioRxiv - Genetics 2019
Quote:
... repair templates and nuclease-free water were added to the mixtures and loaded into pulled injection needles (1B100F-4, World Precision Instruments, Sarasota, FL). Individual injected P0 animals were transferred to new 6 cm NGM plates approximately 18 hours after injections ...
-
No products found
because this supplier's products are not listed.
R Castro, et al.,
bioRxiv - Biochemistry 2023
Quote:
... The animals were housed individually and had free access to water and to one of the following diets prepared based on AIN 93G (Research Diets, New Brunswick, NJ, USA): a control diet (11 Kcal% fat ...
-
No products found
because this supplier's products are not listed.
Ghina Zia, et al.,
bioRxiv - Bioengineering 2024
Quote:
... The vials were then placed in a temperature-controlled water-bath (PolyScience, 2L water bath) set to temperatures in the range ∼20 – 90 °C ...
-
No products found
because this supplier's products are not listed.
Julie Paxman, et al.,
bioRxiv - Cell Biology 2021
Quote:
... DI water and Scotch tape (3M) and each was aligned to a custom Singer ROTOR compatible fixture ...
-
No products found
because this supplier's products are not listed.
Kai Huang, et al.,
bioRxiv - Microbiology 2024
Quote:
... and dissolved oxygen of water samples were measured in situ using a portable water quality analyzer (YSI 6600v2). Ammonia nitrogen was determined using the spectrophotometric method with Nessler’s reagent (HJ 535-2009) ...
-
No products found
because this supplier's products are not listed.
Priya Bhardwaj, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The pieces were weighed and placed on a 10cm dish with 10mL of basal (phenol red free, serum free, and supplement mix free) mammary epithelial cell growth media (PromoCell #C-21215) containing 0.1% BSA ...
-
No products found
because this supplier's products are not listed.
Austin J. Graham, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... sodium DL-lactate (NaC3H5O3, TCI, 60% in water), sodium fumarate (Na2C4H2O4 ...
-
No products found
because this supplier's products are not listed.
Zonghao Qiu, et al.,
bioRxiv - Molecular Biology 2022
Quote:
The RNase R was digested following the manufacturer’s instructions (BioVision), 1μg of linear or circular RNA was digested with 1U of RNase R for 15-30 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Mariona Baliu-Piqué, et al.,
bioRxiv - Immunology 2021
Quote:
... mice received 8% deuterated water (99.8% 2H2O, Cambridge Isotope Laboratories) in their drinking water for 28 days ...
-
No products found
because this supplier's products are not listed.
L. Robert Hollingsworth, et al.,
bioRxiv - Immunology 2020
Quote:
... rinsed with water and imaged via Odyssey CLx (LI-COR). Primary antibodies used in this study include ...
-
No products found
because this supplier's products are not listed.
James W. Truman, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... The kit solutions were resuspended in UltraPure water (Cayman Chemical). The readings were compared to a standard curve derived from serial dilutions of the 20E standard and quality control provided by the kit.
-
No products found
because this supplier's products are not listed.
Mojdeh Dinarvand, Malcolm P. Spain,
bioRxiv - Microbiology 2020
Quote:
... and WFIII fraction collector) and preparative (Waters 600 HPLC pump, Phenomenex reversed-phase column ...
-
No products found
because this supplier's products are not listed.
Farzaneh Mahmoudi-Kordi, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... samples shook again and incubated in hot water bath (IKA, HB digital) at 50°C for 30 min ...
-
No products found
because this supplier's products are not listed.
Rishi Kumar Nageshan, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Precast gels (Mini-PROTEAN TGX Stain-Free Gels #4568084) were used with Biorad buffer (#1610732 and #1610734).Media and growth conditions were as previously described66 ...
-
No products found
because this supplier's products are not listed.
Collin D. Heer, et al.,
bioRxiv - Microbiology 2020
Quote:
... Pathogen-free C57BL/6 mice were purchased from Jackson Laboratories and maintained in the animal care facility at the University of Kansas.
-
No products found
because this supplier's products are not listed.
Andres R. Henriquez, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... Serum free fatty acids were measured using kits from Cell Biolabs, Inc (San Diego ...