-
No products found
because this supplier's products are not listed.
Lauren E. Stopfer, et al.,
bioRxiv - Cancer Biology 2022
Quote:
PRMScan ubiquitin remnant motif (anti-K-ε-GG) antibody beads (Cell Signaling Technology, #5562) were crosslinked as previously described.(60 ...
-
No products found
because this supplier's products are not listed.
Killian S. Hanlon, et al.,
bioRxiv - Bioengineering 2023
Quote:
... A separate qPCR reaction for each sample was performed to detect the NHP gene UBE2D2 (ubiquitin conjugating enzyme E2 D2) using the Taqman Gene Expression Assays 20x mix (Catalog #4351372, assay ID Mf07285893_s1, ThermoFisher Scientific). AAV genomes were inferred from the AAV plasmid standard curve and adjusted to AAV genomes/µg of genomic DNA ...
-
No products found
because this supplier's products are not listed.
Swapnil Rohidas Shinde, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 750 nM ubiquitin conjugating enzyme UBCH5B (R&D Systems, E2622100), 2 mM ATP ...
-
No products found
because this supplier's products are not listed.
Jaehyeon Jeong, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... E2 enzymes were purchased (ab139472, Abcam, USA) and the experiments were performed according to the manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Juan Pablo Arroyo, et al.,
bioRxiv - Physiology 2022
Quote:
... anti-aquaporin E2 FITC conjugated sc-515770 (Santa Cruz) 1:100 overnight ...
-
No products found
because this supplier's products are not listed.
Angela Ya-Chi Mo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Ubiquitin activating enzyme (UAE) inhibitors PYR-41 (Sigma-Aldrich N2915-5MG) was used at 50 nM ...
-
No products found
because this supplier's products are not listed.
Young-Mee Kim, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... The secondary antibody was prepared by conjugating anti-rat IgG2 antibody (BioLegend, 407502) with DyLight 633 (Thermofisher ...
-
No products found
because this supplier's products are not listed.
Laura Pezzè, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... antibodies or with their isotype controls (FITC mouse IgG2a, k isotype, and APC mouse IgG2b, k isotype, BD Bioscience) in ice for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Orsolya Bilkei-Gorzo, et al.,
bioRxiv - Biochemistry 2022
Quote:
... Total-ubiquitin antibody was purchased from DAKO (ZO458). Anti-Syntaxin 7 (sc-514017 ...
-
No products found
because this supplier's products are not listed.
Stefania Zuppone, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... the unencapsulated FITC-dextran or FITC-SAP was removed by washing and filtration using Amicon Ultra centrifugal filters (100 K device, Merck Millipore). The incorporation of FITC-dextran and FITC-SAP into the nsEVs was confirmed by spectrofluometer analysis (FP-6200 ...
-
No products found
because this supplier's products are not listed.
Jean-Philippe Guégan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... ubiquitin activating enzyme E1 (100 nM, Enzo Life Sciences, Villeurbanne, France), E2 UbcH5c (2.5 µM ...
-
No products found
because this supplier's products are not listed.
Jeffrey Chin, et al.,
bioRxiv - Microbiology 2024
Quote:
... and prostaglandin E2 (Cayman Chemicals).
-
No products found
because this supplier's products are not listed.
Zhuoyao Chen, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... The ubiquitin E1 and E2 plasmids were gifts from Cheryl Arrowsmith (Addgene plasmids #25213 ...
-
No products found
because this supplier's products are not listed.
Fletcher J. Young, et al.,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... and Cy3-conjugating secondary antibody (Cy3 goat anti-rabbit IgG: 111-165-144, Jackson ImmunoResearch, RRID: AB_2338006) was used to label neural membranes to confirm that counted nuclei were neuronal (74) ...
-
No products found
because this supplier's products are not listed.
Apurva T. Prabhakar, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... HA) (E1), HPV16 E2, pGL3 Basic, pGL3 Control, ptk6E2 (22, 68, 69) E2-K mutant plasmids were generated by GenScript.
-
No products found
because this supplier's products are not listed.
Shotaro Namba, Hisao Moriya,
bioRxiv - Cell Biology 2024
Quote:
... and ubiquitin was blocked with anti-ubiquitin was detected using an anti-GFP antibody (Roche) and ubiquitin was detected using an anti-ubiquitin antibody (Santa Cruz) ...
-
No products found
because this supplier's products are not listed.
Lucie Wolf, et al.,
bioRxiv - Cell Biology 2020
Quote:
... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.
-
No products found
because this supplier's products are not listed.
Ran-Der Hwang, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The coverslips were incubated with primary antibodies (anti-Ubiquitin ab7780, Abcam; anti-Ubiquitin BML-PW8810, Enzo; or anti-LC3B, 14600-1-AP, Proteintech) at 4°C overnight ...
-
No products found
because this supplier's products are not listed.
K. Futrega, et al.,
bioRxiv - Bioengineering 2020
Quote:
... and anti-sheep antibodies: CD45-FITC and CD44-FITC (Bio-Rad). Cells were stained as per the manufacturers’ instructions and analysis was completed using an LSR II flow cytometer (BD Biosciences ...
-
No products found
because this supplier's products are not listed.
Lore Billiet, et al.,
bioRxiv - Immunology 2022
Quote:
... CD158e1/e2 (KIR3DL/DS1, Beckman Coulter, IM3292), EVI2B (CD361 ...
-
No products found
because this supplier's products are not listed.
Karishma Bakshi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... anti-GFP antibody FITC (NB100-1771, Novus Biologicals).
-
No products found
because this supplier's products are not listed.
William Peeples, Michael K. Rosen,
bioRxiv - Biochemistry 2020
Quote:
... E2 and polyPRM5 proteins were purified using Ni NTA-agarose (Qiagen) followed by cation exchange (Source15S ...
-
No products found
because this supplier's products are not listed.
Benjamin D. Gastfriend, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The CD31-FITC antibody (Miltenyi Biotec, Auburn, CA) was added to the cell suspension at a dilution of 1:50 ...
-
No products found
because this supplier's products are not listed.
Ivy Aneas, et al.,
bioRxiv - Genomics 2020
Quote:
... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA] ...
-
No products found
because this supplier's products are not listed.
Poonam Kakade, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Halo-tagged ubiquitin-binding domains (UBDs) of TUBE (tandem-repeated ubiquitin-binding entities) was incubated with HaloLink resin (200 μL, Promega) in binding buffer (50 mm Tris⍰HCl ...
-
No products found
because this supplier's products are not listed.
Takamasa Kudo, et al.,
bioRxiv - Systems Biology 2022
Quote:
... FITC-conjugated anti-mouse antibody (Jackson Laboratory #115-095-166), Rhodamine-conjugated anti-rabbit antibody (Jackson Laboratory ...
-
No products found
because this supplier's products are not listed.
D.M. Jeziorska, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... and rabbit anti-sheep FITC antibodies (FI-6000, Vector Laboratories, RRID: AB_2336218). Widefield fluorescence imaging was performed on a DeltaVision Elite system (Applied Precision ...
-
No products found
because this supplier's products are not listed.
Olivia S. Shin, et al.,
bioRxiv - Immunology 2024
Quote:
... goat F(ab′)2 anti-human kappa FITC and goat F(ab′)2 anti-human lambda FITC (SouthernBiotech; to detect antibody expression), and PI (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Nathalie A. Reilly, et al.,
bioRxiv - Genomics 2024
Quote:
... 2μL Tn5 enzyme (Tn5 enzyme (Illumina, 15027865) and TD Tagment DNA Buffer (Illumina ...
-
No products found
because this supplier's products are not listed.
Rui Yan, Kun Chen, Ke Xu,
bioRxiv - Cell Biology 2021
Quote:
... rabbit anti-RFP magnetic beads were prepared by conjugating 5 μg rabbit anti-RFP antibody (Rockland 600-401-379) to 50 μL Protein G magnetic beads (Invitrogen 10003D ...
-
No products found
because this supplier's products are not listed.
David A. Kukla, et al.,
bioRxiv - Bioengineering 2020
Quote:
... or rabbit anti-mouse FITC antibody (1:100) (GeneTex) in dilution solution for 3 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Hila Shaim, et al.,
bioRxiv - Immunology 2020
Quote:
... and B7-H6-FITC (Bioss antibodies) for 20 minutes before washing and acquiring by flow cytometry.
-
No products found
because this supplier's products are not listed.
Junjiao Wu, Yu Tang,
bioRxiv - Molecular Biology 2024
Quote:
... Ubiquitin (1:800; ABclonal A19686), eIF2α (1:1000 ...
-
No products found
because this supplier's products are not listed.
Sarah Cherkaoui, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... Antigen retrieval was performed with E2 (Leica Microsystems) retrieval solution for 20min ...
-
No products found
because this supplier's products are not listed.
Ilia Gelfat, et al.,
bioRxiv - Microbiology 2021
Quote:
... followed by an anti-E-tag-FITC antibody (Bethyl Laboratories) at 1:100 dilution ...
-
No products found
because this supplier's products are not listed.
Wan Hua Li, et al.,
bioRxiv - Biochemistry 2021
Quote:
... SARM1-dN was pulled down by BC2 nanobody(Bruce et al., 2017) conjugated beads which were prepared by conjugating BC2 nanobody to NHS-beads (GE Healthcare). The purified SARM1-dN ...
-
No products found
because this supplier's products are not listed.
Kunxin Wu, et al.,
bioRxiv - Pathology 2024
Quote:
... / Ubiquitin (Agrisera) antibody.
-
No products found
because this supplier's products are not listed.
Shuang Wang, et al.,
bioRxiv - Microbiology 2020
Quote:
... anti-FcγRIIIa antibody-FITC (Cat: 10389-MM41-F, Sino Biological) and FITC-labeled anti-FcγRIIb antibody (Cat ...
-
No products found
because this supplier's products are not listed.
Takuya Osakada, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Flu-positive cells were visualized with anti-FITC antibody (PerkinElmer, #NEF710001EA ...
-
No products found
because this supplier's products are not listed.
Ana Lucia Rosales Rosas, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Primary antibody anti-E2 protein [Chk265] (Absolute Antibody, Wilton, UK) was diluted in PBS-T (1:500 ...
-
No products found
because this supplier's products are not listed.
Jeffery M.R.B. McAlpine, et al.,
bioRxiv - Biochemistry 2024
Quote:
... Labelled ubiquitin was visualised using an Odyssey Fc system (LI-COR) at 600 nm with a 2 min exposure ...
-
No products found
because this supplier's products are not listed.
J. Kleinehr, et al.,
bioRxiv - Microbiology 2022
Quote:
... Intracellular staining of influenza A nucleoprotein was done by applying the anti influenza A (nucleoprotein) – FITC antibody (OriGene, AM00924FC-N) for 60 min at 4 °C in the dark ...
-
No products found
because this supplier's products are not listed.
Kathleen M. Mulvaney, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... the complex was biotin-labeled via incubation with recombinant sortase A5 enzyme (Active Motif) and a custom tri-glycine biotin peptide (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Michelle S Glossop, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... NUDT16L1 antibody (Atlas Antibodies) and CRM1 antibody (Santa Cruz ...
-
No products found
because this supplier's products are not listed.
Emily C. Wright, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sections were blocked in 10% normal goat serum for 20 minutes and then incubated in rabbit anti-cfos (Synaptic Systems, 1:K) in PBS 0.5% TritonX overnight at room temperature ...
-
No products found
because this supplier's products are not listed.
Brian Olson, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-CD4 antibody and anti-CD8 antibodies (BioXCell, Lebanon ...
-
No products found
because this supplier's products are not listed.
Adriana Savova, Julia Romanov, Sascha Martens,
bioRxiv - Cell Biology 2020
Quote:
Testing of the interaction of the NBR1 variants with p62 was performed in a similar manner by conjugating a total of 25ug mCherry-p62 to RFP trap beads (Chromotek, rta-20).
-
No products found
because this supplier's products are not listed.
Xiaoyan Wei, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and for 15 minutes at 100°C in a proteinase K/elution buffer mix (1 µl of proteinase K in 100 µl DIB-buffer; Diagenode). Capture efficiency was determined by qPCR against spiked-in Lambda-DNA fragments in precapture and postcapture library samples ...
-
No products found
because this supplier's products are not listed.
Ilia Kats, et al.,
bioRxiv - Cell Biology 2020
Quote:
... pH 2.0) and re-probed with mouse anti-ubiquitin (P4G7) followed by goat anti-mouse IgG-HRP (#115-035-003, Dianova) and imaging.
-
No products found
because this supplier's products are not listed.
David O. Dias, et al.,
bioRxiv - Neuroscience 2020
Quote:
... GFP (1:2000, goat directly conjugated to FITC, Abcam; 1:10000, chicken, Aves Labs), PDGFRβ (1:200 ...