Labshake search
Citations for Origene Technologies :
1 - 50 of 141 citations for Ubiquitin Conjugating Enzyme E2 K UBE2K Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Intracellular staining of influenza A nucleoprotein was done by applying the anti influenza A (nucleoprotein) – FITC antibody (OriGene, AM00924FC-N) for 60 min at 4 °C in the dark ...
-
bioRxiv - Immunology 2024Quote: ... TCR-T cells were tested for activation-induced cytolytic responses by coincubation with target cells (1:1) overnight followed by staining with anti-murine TCR constant domain antibody (FITC, CL075F, Origene) and anti-CD107a mAb (PE-Cy5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... the slides were washed three times with PBS and incubated with secondary antibodies (hypersensitive enzyme-labeled goat anti-mouse/rabbit IgG polymer (OriGene, China) at room temperature for 20 min ...
-
bioRxiv - Immunology 2024Quote: ... and anti-murine TCR constant domain (FITC, CL075F, Origene, Rockville, MD, USA). TCR-T cells were tested for activation-induced cytolytic responses by coincubation with target cells (1:1 ...
-
bioRxiv - Cell Biology 2022Quote: 70% confluent HEK293T cells were transfected with Flag-tagged Mena in pcDNA3.1+/C-(K)DYK (obtained from Origene; Omu14068c) using calcium phosphate-based transfection ...
-
bioRxiv - Genomics 2021Quote: ... Amplicons were digested with restriction enzymes AsiSI / MluI and inserted into pCMV6-AC-turboGFP vector (Origene, PS100010). Full-length human NKX2-5 cDNA was amplified with 5’ primer (ATTAGGATCCATGTTCCCCAGCCCTG ...
-
bioRxiv - Genomics 2021Quote: ... Amplicons were digested with restriction enzymes AsiSI / MluI and inserted into pCMV6-AC-turboGFP vector (Origene, PS100010).
-
bioRxiv - Cell Biology 2023Quote: ... anti-KRas antibody (OriGene, mouse monoclonal #CF801672 ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibodies used: YFP Goat polyclonal antibody (1:500) (ORIGENE, Cat.No. AB1166-100), mouse mCherry antibody (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: The antibodies used in the study include: polyclonal rabbit anti-RBBP6 antibody (Origene Technologies, TA309830), polyclonal rabbit anti-hnRNPL (Abcam ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-DDK (FLAG) antibody (OriGene, #TA150014) or rabbit IgG (Cell Signaling ...
-
bioRxiv - Cell Biology 2020Quote: ... GAPDH antibody is from OriGene (TA802519). HSC70 antibody is from Enzo (ADI-SPA-815-F) ...
-
bioRxiv - Molecular Biology 2024Quote: ... goat anti-TdTomato antibody (OriGene, AB8181), and mouse anti-Cox4 antibody (R&D Systems ...
-
bioRxiv - Cancer Biology 2022Quote: Western blot antibodies for GOT2 detection were rabbit anti-human GOT-2 polyclonal antibody (Origene, catalog #TA325088) and HRP-conjugated AffiniPure Goat anti-rabbit IgG (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... primary antibody was applied overnight at 4 °C including antibodies against β-catenin (cat# AB0095-200, OriGene), β-Actin (cat# 4967 ...
-
bioRxiv - Cell Biology 2021Quote: ... Incubation with primary antibodies at 37°C for 1h included goat β-catenin antibody (cat# AB0095) from OriGene Biotechnologies (Rockville ...
-
bioRxiv - Cancer Biology 2022Quote: ... Fh1 antibody was purchased from Origene (TA500681), Myc antibody from Cell Signaling Technologies (18583S) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Klf5 antibody (1:100, TA811868, Origene), anti-Bmp7 antibody (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... mouse monoclonal anti-DDK antibodies from Origene; mouse monoclonal anti-myogenin antibodies from BD Biosciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used included Ki67 (ORIGENE, TA802544) and cleaved caspase-3 (Cell Signaling Technology ...
-
bioRxiv - Bioengineering 2023Quote: ... Alpha Tubulin (TUBA4A) mouse monoclonal antibody (Origene) and MUC5AC monoclonal antibody (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:150 SETD7 Mouse Monoclonal Antibody (OriGene); and 1.5% NSD in 1 X PBS-Triton X-100 solution] overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... with primary antibodies against Trim39 (Origene, 1:400) and NFATc3 (Proteintech ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-MYC antibody 9E10 was from Origene, the anti-Strep-tag antibody from Biorad ...
-
bioRxiv - Biochemistry 2022Quote: ... Primary antibodies (PANK1 CST 1:1000; PANK2 Origene 1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-ALPPL2 affinity-purified rabbit polyclonal antibody (Origene) or anti-ALPPL2 mouse antibody (Clone SPM593 ...
-
bioRxiv - Neuroscience 2023Quote: ... CRHR2 antibody (1:1000, ORIGENE, rabbit, AP17244PU-N), Grin2B antibody (1:1000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Antibodies used are as follows: for immunoprecipitation (OriGene, CAT #TA-50011-3 and Origene ...
-
bioRxiv - Biochemistry 2023Quote: ... and rabbit anti-mKate2 antibodies (1:2000, Origene). The protein bands were obtained using horseradish peroxidase-conjugated antibodies against mouse whole immunoglobulins and horseradish peroxidase-conjugated antibodies against rabbit whole immunoglobulins (1∶10,000 ...
-
bioRxiv - Microbiology 2024Quote: ... and anti-CD3 antibody at 1:150 (OriGene) tagged to AlexaFluor 647 antibodies were used for immunostaining of slides ...
-
bioRxiv - Plant Biology 2024Quote: ... The separated proteins were then subjected to immunoblotting using GST antibody (M20007L; Abmart; 1:5,000 dilution) and His antibody (F013; ORIGENE; 1:5,000 dilution) or MBP antibody (AE016 ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit polyclonal anti-CCL5 antibody (Origene Cat# PP1081P1, RRID:AB_1006884) was used for the neutralization of CCL5 chemokine.
-
bioRxiv - Biochemistry 2022Quote: ... and the other with anti-METTL7A primary antibody (Origene, Rockville MD ...
-
bioRxiv - Microbiology 2020Quote: ... anti-TRAF6 or anti-MEKK3 antibodies (all from Origene). A rabbit monoclonal anti-BST-2 antibody (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse monoclonal antibody against Trim39 was from Origene (#TA505761). Rabbit polyclonal antibody against Trim39 was from Proteintech (#12757-1-AP) ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were immunoblotted using antibodies against Psf1 (Origene, TA339351) Psf2 (Novus Biologicals ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies against SC2 included rabbit anti-Nucleoprotein MAb (Origene) and rabbit anti-Spike MAb (Origene) ...
-
bioRxiv - Microbiology 2021Quote: ... and immunostained with antibodies against IFIT1 (Origene TA500948, clone OTI3G8), MX1/2 (Santa Cruz sc-47197) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-Rab IgG secondary rabbit antibody (OriGene Technologies, U.S.) were diluted at 1:5000 for incubation with the membrane ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-CCR7 polyclonal antibody (TA310252, Origene, Rockville, MD). The secondary antibodies were FITC- ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunohistochemistry was performed using the following antibodies: SETD7 (Origene, TA503322), GFP (Aves Lab ...
-
bioRxiv - Biochemistry 2024Quote: ... and mouse α-PUS7 monoclonal antibody (OriGene, OTI4C6; 1:1,000) followed by goat α-rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-GAPDH antibody (TA802519) is from Origene (WB-1:5000), anti-HA antibody (C29F4 ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies used were hnRNPM (Origene technologies, TA301557, 1:50,000), GAPDH (EMD Millipore ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies were rabbit anti-Tlr5 (Origene, Rockville, MD; 1:200), and mouse anti-SP-C (Santa Cruz ...
-
bioRxiv - Neuroscience 2024Quote: ... Primary antibodies: goat anti-mCherry (1:1000) (Origene AB0040-200), chicken anti-GFP (1:500 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 1 µg/ml of biotinylated anti-huEL monoclonal antibody (OriGene) was added at 35 µl/well and incubated for additional 60 minutes ± 10 minutes at RT on a plate shaker ...
-
bioRxiv - Molecular Biology 2022Quote: Sandwich ELISA was performed with mouse anti-NDV-HN antibodies (OriGene) diluted 1:100 in PBS for 1 h to capture whole attenuated NDV (VH ...
-
bioRxiv - Microbiology 2021Quote: ... a rabbit anti-C.a polyclonal antibody at 25 µg/mL (OriGene) counterstained with a secondary goat anti-rabbit IgG conjugated with Alexa Fluor 555 at 0.4 µg/mL (Invitrogen ...