Labshake search
Citations for New England Biolabs :
1 - 50 of 3226 citations for Ubiquitin Conjugating Enzyme E2 K UBE2K Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.
-
bioRxiv - Microbiology 2021Quote: ... Cleavage reactions were quenched by eliminating enzymes with the treatment with Proteinase K (1.6 U, NEB) and the products were analyzed by capillary gel electrophoresis (CE assay) ...
-
bioRxiv - Biochemistry 2020Quote: ... by conjugating ATTO594-maleimide (ATTO-TECH) to Coenzyme A-SH (New England Biolabs), followed by HPLC purification ...
-
bioRxiv - Developmental Biology 2023Quote: ... Coding sequences for mouse Gata4 and E2-Crimson preceded by an E2A self-cleaving peptide (E2A-E2-Crimson) were assembled using NEBuilder HiFi DNA assembly (NEB) to generate pCX-Gata4-E2A-E2-Crimson ...
-
bioRxiv - Biophysics 2020Quote: ... samples were incubated in digestion enzyme buffer consisting of digestion buffer supplemented with (0.5%) proteinase K (P8107S, New England Biolabs) and 5% Pronase (11459643001 ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... Recombinant Muc1 or lubricin mixed with one of the following enzymes: 8 unit/mL of proteinase K (P8107S, New England Biolabs), 500 μg/mL of pronase (10165921001 ...
-
bioRxiv - Cancer Biology 2021Quote: ... proteinase K (NEB) and heat for decrosslinking followed by Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteinase K (NEB) (digests most peptide bonds ...
-
bioRxiv - Immunology 2020Quote: ... Proteinase K (NEB) for 1 hour at 50°C ...
-
bioRxiv - Microbiology 2023Quote: ... Proteinase K (NEB) and incubated at 56 degrees C overnight ...
-
bioRxiv - Genomics 2023Quote: ... proteinase K (NEB) for 1 hour at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... proteinase K(NEB) and RNase A (Solarbio ...
-
bioRxiv - Microbiology 2023Quote: ... proteinase K (NEB) (10 μl of 20mg/mL ...
-
bioRxiv - Developmental Biology 2023Quote: ... The resulting PX458-E2-Crimson vector was digested using BbsI-Hf (NEB) and single guide RNA (sgRNA ...
-
bioRxiv - Genomics 2020Quote: ... is added to the Proteinase K (NEB Proteinase K #P8107S; ProK) reactions to inactive the ProK prior to coupling to streptavidin beads ...
-
bioRxiv - Molecular Biology 2024Quote: Restriction enzymes: all restriction enzymes acquired from NEB: BbsI (R0539S) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proteinase K (NEB). The substrate was obtained by PCR on CML cells derived gDNA using Q5 DNA polymerase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... and Proteinase K (NEB). Genomic DNA was sonicated (Q800R2 QSONICA ...
-
bioRxiv - Genomics 2023Quote: ... and proteinase K (BioLabs) treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protease K (P8107S, NEB). Antibodies used were ...
-
bioRxiv - Genetics 2024Quote: ... the proteinase K (NEB) was added and incubated for 2 h at 55 °C to digest protein and the RNase A (Thermo ...
-
bioRxiv - Plant Biology 2024Quote: ... Proteinase K (NEB, P8107S) and RNase A (20 mg/ml ...
-
bioRxiv - Biochemistry 2024Quote: ... and proteinase K (NEB), followed by phenol–chloroform extraction and ethanol precipitation ...
-
bioRxiv - Developmental Biology 2024Quote: ... Proteinase K (NEB P8107S) incubation was also performed overnight at 65 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The ubiquitin (in vivo) and 3xFlag-TEV (using TEV protease, NEB) fusions were removed to reveal three N-terminal glycines required for N-terminal sortase-mediated labeling ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Plant Biology 2020Quote: ... restriction enzyme (NEB), which only digests the wild-type MSL10 gene ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Restriction enzymes (NEB) and T4 ligase (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... Restriction enzymes (NEB) were used according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... restriction enzymes (NEB), and T4 DNA ligase (NEB).
-
bioRxiv - Microbiology 2021Quote: ... Restriction enzymes (NEB) digestion was carried out for respective PCR products and the expression vector pcDNA3.1 (+) ...
-
bioRxiv - Developmental Biology 2020Quote: ... digested (NEB enzyme) and used to produce digoxygenin-labeled RNA antisense probes (Synthesis with Roche reagents ...
-
bioRxiv - Microbiology 2020Quote: ... USER enzyme (NEB) was used to degrade the dUTP-containing strand by adding 1 unit of USER to purified cDNA and incubating for 30 min at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... restriction enzymes (NEB), T4 DNA Ligase (NEB #M0202L) ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes (NEB), T4 DNA Ligase (NEB) ...
-
bioRxiv - Microbiology 2022Quote: ... restriction enzymes (NEB), Zymoclean Gel DNA Recovery Kits (Zymo Research) ...
-
bioRxiv - Neuroscience 2021Quote: Proteinase K (New England Biolabs) was diluted 1:100 to 8 units/mL in digestion buffer (50 mM Tris (pH 8) ...
-
bioRxiv - Genomics 2020Quote: ... Proteinase K (New England Biolabs) was added to a final concentration of 4 units/ml and incubated 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 0.8U Proteinase K (NEB) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... Proteinase K (New England BioLabs) and dithiothreitol (DTT).
-
bioRxiv - Biochemistry 2022Quote: ... Thermolabile Proteinase K (NEB, P8111S) with 15 mM EDTA was added to the reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 μl Proteinase K (NEB), and 24 μl H2O and incubated samples for 1.5 hours at 55°C ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with Proteinase K (NEB), and incubated 1?h at 56°C ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Immunology 2021Quote: ... 1% Proteinase K (NEB, P8107S) solution ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...
-
bioRxiv - Microbiology 2023Quote: ... with added Proteinase K (NEB). Samples were incubated ...
-
bioRxiv - Genomics 2023Quote: ... proteinase K (NEB, P8107S, USA), 501l] for 48 h at humidified 37 ℃ cell culture incubator ...
-
bioRxiv - Cell Biology 2023Quote: Proteinase K (New England Biolabs) was diluted 1:100 to 8 units/mL in digestion buffer (50 mM Tris (pH 8) ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteinase K (New England BioLabs) was added to the sample and further incubated under permanent rotation for 30 min ...