-
No products found
because this supplier's products are not listed.
Trevor J. Hancock, et al.,
bioRxiv - Immunology 2022
Quote:
... as well as TGEV (transmissible gastroenteritis virus) (VMRD, Pullman, WA, USA). Normal cat serum was purchased from Jackson ImmunoResearch (West Grove ...
-
No products found
because this supplier's products are not listed.
Zhenming Jin, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and Anti-virus Drug Library (Shanghai Institute for Advanced Immunochemical Studies, SIAIS), which includes ∼10,000 compounds ...
-
No products found
because this supplier's products are not listed.
Subeena Sood, et al.,
bioRxiv - Immunology 2023
Quote:
... A fixed concentration of SARS-CoV-2 GFP pseudotyped virus (BPS Biosciences) was added and the plate incubated for 60 minutes at 37°C and 5% CO2 ...
-
No products found
because this supplier's products are not listed.
Katharina Kases, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... and anti- ZC3H11A (Atlas Antibodies, heavy lysate) antibodies in Protein LoBind tubes (Eppendorf) ...
-
No products found
because this supplier's products are not listed.
Hongyan Sui, et al.,
bioRxiv - Immunology 2019
Quote:
HSV-1 (MacIntyre strain) and Sendai virus (SeV) were obtained from Advanced Biotechnologies Inc ...
-
No products found
because this supplier's products are not listed.
Luis E. Martinetti, et al.,
bioRxiv - Neuroscience 2021
Quote:
... we used a virus-retrobead or saline-retrobead mixture (red RetroBeads, Lumafluor, Cat# R180). When comparing different AAV serotypes ...
-
No products found
because this supplier's products are not listed.
Sheng Xiao, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Virus was injected using a manual volume displacement injector (Narishige International USA, MMO-220A) connected to a glass pipette (Drummond Scientific ...
-
No products found
because this supplier's products are not listed.
Marion A. Deroche, et al.,
bioRxiv - Neuroscience 2019
Quote:
... NESS 0327 from Cayman Chemical (Bertin Bioreagent, St. Quentin en Yvelines, France).
-
No products found
because this supplier's products are not listed.
Susan A. Leonhardt, et al.,
bioRxiv - Biophysics 2022
Quote:
... virus-containing supernatants were filtered and placed in poly-lysine-coated glass-bottom dishes (MatTek). Particles were then washed and stained with Alexa594-annexin V (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Lukas-Adrian Gurzeler, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Lysates were reduced with 10 mM DTT (Indofine Chemicals) at 30°C for 30 min ...
-
No products found
Oliver Hsia, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Lysate was filtered through a BioPrepNylon Matrix Filter (BioDesign) then incubated with 1 mL Ni-NTA resin per litre culture for 1 hour ...
-
No products found
because this supplier's products are not listed.
James S. Dhaliwal, et al.,
bioRxiv - Cell Biology 2020
Quote:
... Cleared lysates were then incubated with α8-oxoG (QED Bioscience) at 4°C for 1 hr to capture ORBs ...
-
No products found
because this supplier's products are not listed.
Lisa-Marie Kuhl, et al.,
bioRxiv - Genetics 2020
Quote:
... Cell lysates were mixed on a VXR basic Vibrax (IKA) for 2 min at 1500 rpm ...
-
No products found
because this supplier's products are not listed.
Han Kang Tee, et al.,
bioRxiv - Microbiology 2019
Quote:
... The viral loads in organs were determined using TaqMan fast virus 1-step master mix (ABI, USA). One step RT-PCR was also performed to amplify viral RNA from the organs using MyTaq One-Step RT-PCR kit (Bioline ...
-
No products found
because this supplier's products are not listed.
Paulo J. da Costa, et al.,
bioRxiv - Molecular Biology 2019
Quote:
Protein lysates mixed with 1x SDS-PAGE Sample Loading Buffer (NZYtech) were denatured at 95°C for 10 minutes and centrifuged at 500g for 5 minutes ...
-
No products found
because this supplier's products are not listed.
Naureen Javeed, et al.,
bioRxiv - Cell Biology 2019
Quote:
... total protein lysates was isolated using NP-40 buffer (Amresco, J619) supplemented with protease/phosphatase inhibitor cocktail (Cell Signaling Technology ...
-
No products found
because this supplier's products are not listed.
Marie A Brunet, et al.,
bioRxiv - Genetics 2020
Quote:
... Human tissue lysates for altFUS endogenous expression were purchased from Zyagen Laboratories (San Diego ...
-
No products found
because this supplier's products are not listed.
Yanhua Du, et al.,
bioRxiv - Epidemiology 2019
Quote:
The genomes of SFTS virus isolates were compiled using the SeqMan program in the LaserGene software package (DNAStar). The percentage similarities of nucleotide identity or amino acid identity were calculated using the ClustalX software[16] ...
-
No products found
because this supplier's products are not listed.
Paul A. Rowley, et al.,
bioRxiv - Evolutionary Biology 2020
Quote:
Human brain and testes tissue total protein lysates were purchased from ProSci Incorporated (catalogue numbers 1303 and 1313 ...
-
No products found
because this supplier's products are not listed.
Bioy Alexis, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... supernatants (1 μg/mL of lysate) were treated with DNAse I (Eurogentec) for 1 hour on ice ...
-
No products found
because this supplier's products are not listed.
Emily S. Norton, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... lysates were clicked to 10 μM DBCO-S-S-PEG3-biotin (BroadPharm) for 6 hours at room temperature ...
-
No products found
because this supplier's products are not listed.
Maayan Karlinski Zur, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... The lysates were transferred into soft tissue homogenizing CK14 tubes (Bertin Corp), placed in a homogenizer shaker at 400bps for 2 sec ...
-
No products found
because this supplier's products are not listed.
Wilfred A. Jefferies, et al.,
bioRxiv - Immunology 2023
Quote:
... or LNP-B.1.617.2 (Delta) spike protein variant of the SARS-CoV-2 virus (Cat # PM-LNP-12) mRNA purchased from Promab Biotechnologies ...
-
No products found
because this supplier's products are not listed.
Filippo Bianchini, et al.,
bioRxiv - Immunology 2022
Quote:
... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
No products found
because this supplier's products are not listed.
Lydia-Ann L.S. Harris, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Louis on a JEOL 1200 transmission electron microscope (JEOL USA Inc.) [27].
-
No products found
because this supplier's products are not listed.
Theresa Mau, et al.,
bioRxiv - Epidemiology 2019
Quote:
... using a cold sterilant (Spor-Klenz®, Steris, St Loius, MO) for disinfecting gloved hands or transfer forceps ...
-
No products found
because this supplier's products are not listed.
Sameer Ahmed Bhat, et al.,
bioRxiv - Cell Biology 2023
Quote:
... anti-phospho-cofilin-S3 (St Johns Laboratory, STJ90230; 1:2000 IB); anti-cofilin (CST ...
-
ST271 is a tyrphostin-like protein tyrosine kinase (PTK) inhibitor which inhibits phospholipase...
Cat# S6522, SKU# S6522-5mg,
5mg, $97.00
Ask
Nila Roy Choudhury, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Cells were incubated with virus for 1.5 hours before the addition of virus growth media (DMEM, 0.14% BSA, 1 μg/mL TPCK-treated trypsin) supplemented with 500 μM of Favipiravir (Selleck Chemicals) or DMSO ...
-
No products found
because this supplier's products are not listed.
M. Julhasur Rahman, et al.,
bioRxiv - Microbiology 2021
Quote:
The mCherry-E3L integration sites in the purified HGT virus genomes were located by inverse PCR amplification and by PacBio sequencing ...
-
No products found
because this supplier's products are not listed.
Michael D. Vahey, Daniel A. Fletcher,
bioRxiv - Microbiology 2019
Quote:
... replacing media with virus growth media supplemented with or without a specified concentration of oseltamivir carboxylate (Toronto Research Chemicals O700980), but without TPCK-treated trypsin ...
-
No products found
because this supplier's products are not listed.
Qian Zhou, et al.,
bioRxiv - Neuroscience 2021
Quote:
We delivered ∼150 nl of AAV virus with a stereotaxic instrument (David Kopf Instruments, #PF-3983; RWD Life Science, #68030) and a pressure micro-injector (Nanoject II ...
-
No products found
because this supplier's products are not listed.
Avital Licht-Murava, et al.,
bioRxiv - Neuroscience 2022
Quote:
... per ml culture medium at DIV 8 using Lipofectamine 3000 5 h before infection with vesicular stomatitis virus (VSV) at 100 MOI or with adenovirus-eGFP (Ad5CMV-eGFP, lot #ad3586, Viral Vector Core Facility, Carver College of Medicine ...
-
No products found
because this supplier's products are not listed.
David L. Haggerty, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Flash frozen brain lysates were homogenized using a BeadBug™ 6 (Benchmark scientific Cat No ...
-
No products found
because this supplier's products are not listed.
Nikol Dibus, et al.,
bioRxiv - Cell Biology 2023
Quote:
... lysates were incubated with the PD-1 antibody (1 µg; Exbio #11-176) and mixed with Dynabeads® Protein G ...
-
Cat# ZK312-1,
USD $795.0/mg
Ask
Milica Moskovljevic, et al.,
bioRxiv - Immunology 2024
Quote:
... Cells stimulated with either lysates of CMV-infected fibroblasts (Virusys, 10 μg/mL), overlapping Gag 15mer peptides (HIV-1 Gag peptide pool ...
-
No products found
because this supplier's products are not listed.
Melissa H. Bergeman, et al.,
bioRxiv - Microbiology 2023
Quote:
... Image segmentation and 3D rendering of HSV-1 virus particle undergoing exocytosis from Rab6a vesicle was done in Imaris (Oxford Instruments) by constructing spots and surfaces for the objects at respective image slices ...
-
No products found
because this supplier's products are not listed.
Julie M. Button, Suchetana Mukhopadhyay,
bioRxiv - Microbiology 2021
Quote:
Five microliters of purified virus or pelleted cores were placed on a Formvar and carboncoated 300 mesh grid (Ted Pella Inc., Redding, CA) and stained with 1% uranyl acetate ...
-
No products found
because this supplier's products are not listed.
Anja Konietzny, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Lysates were then analyzed by PCR with corresponding primers and Econo Taq PLUS Green Mix (Euromedex). Primers pairs for testing TTL mouse strain were 5’GGCGACTCCATGGAGTGGTGG and 5’CCCAACATCACATTCTCCAAATATCAAAG (TTL wildtype ...
-
No products found
because this supplier's products are not listed.
Danielle A. Jeffrey, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and pressurized using an arteriography system (Living Systems Instrumentation, Inc., St. Albans, VT, USA). Vessel internal diameter was continuously monitored using a CCD camera and edge-detection software (IonOptix ...
-
No products found
because this supplier's products are not listed.
DaoFei Song, Lei Yin, Chang Wang, XiuYing Wen,
bioRxiv - Molecular Biology 2019
Quote:
... The protein concentration in tissue lysates was measured with a BCA protein assay kit (Boster, Wuhan, China) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Nicholas McCaul, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... IgM was immunoprecipitated from lysates or media samples with a goat anti-mouse IgM antibody (Southern Biotech). Immunoprecipitates were washed with lysis buffer and eluted from beads with reducing SDS-PAGE sample buffer and analyzed by SDS-PAGE ...
-
No products found
because this supplier's products are not listed.
Akira Kitamura, et al.,
bioRxiv - Biophysics 2023
Quote:
... FCCS measurements of the lysates were performed using an LSM510 META ConfoCor3 system (Carl Zeiss, Jena, Germany) equipped with a C-Apochromat 40×/1.2NA W Korr ...
-
No products found
because this supplier's products are not listed.
Julieta Ramirez, et al.,
bioRxiv - Genomics 2023
Quote:
Whole cell lysates were separated on a 5% SDS/PAGE containing 20 μm Phos-tag (NARD Institute), followed by western blotting with anti-CTCF antibody.
-
No products found
because this supplier's products are not listed.
Kelly T. Rios, et al.,
bioRxiv - Microbiology 2024
Quote:
The gametocyte and zygote lysates were mechanically lysed with a 1 mL Dounce homogenizer (Wheaton, Cat# 357538) for one minute on ice with a tight pestle following chemical lysis ...
-
No products found
because this supplier's products are not listed.
Géza V. Burghardt, et al.,
bioRxiv - Molecular Biology 2022
Quote:
Air sampling was conducted using Gilian GilAir Plus Air Sampling Pumps (Sensidyne, St. Petersburg, FL) equipped with polycarbonate filters (0.8 μm pore size ...
-
No products found
because this supplier's products are not listed.
Maya Shofa, Akatsuki Saito,
bioRxiv - Microbiology 2023
Quote:
... or 100 ng/mL pig IFNβ (Kingfisher Biotech, St. Paul, MN, USA, Cat# RP0011S-025). After overnight incubation ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
... the clarified lysate was concentrated by tangential flow filtration at 5 L/min/m2 using a KR2i KrosFlo (Repligen) with Pellicon 2 mini cassettes (300 kDa ...
-
No products found
Liliana M. Sanmarco, et al.,
bioRxiv - Immunology 2023
Quote:
Pyruvate levels were quantified in BMDC lysates after 1h stimulation using EnzyChrom pyruvate assay kit (EPYR-100, BioAssay Systems), followed the procedure suggested by the manufacturer ...
-
No products found
because this supplier's products are not listed.
Nitchakarn Kaokhum, et al.,
bioRxiv - Biochemistry 2022
Quote:
DUB activity in cartilage tissue lysates were measured using ubiquitin-rhodamine(110)-glycine quenched substrate (Boston Biochem, cat No U-555). In the presence of active DUBS ...
-
No products found
because this supplier's products are not listed.
Vi Pham, et al.,
bioRxiv - Cell Biology 2023
Quote:
... SGSH activity was measured from whole cell lysates following a two-step protocol [25] and using 4MU-αGlcNS (Chem-Impex Int’l Inc, Cat #30694) as fluorogenic substrate and with 4-methylumbelliferone (Sigma Aldrich ...