-
No products found
because this supplier's products are not listed.
Pengxiang Chang, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in HBS-EP buffer (TEKnova) containing 10 μM oseltamivir carboxylate (Roche ...
-
No products found
because this supplier's products are not listed.
Olivia S. Shin, et al.,
bioRxiv - Immunology 2024
Quote:
... goat F(ab′)2 anti-human kappa FITC and goat F(ab′)2 anti-human lambda FITC (SouthernBiotech; to detect antibody expression), and PI (Invitrogen ...
-
Recombinant Antigen
Cat# REC31651-100,
100µg USD $711.0
Ask
Carmen Mirabelli, et al.,
bioRxiv - Microbiology 2021
Quote:
... HNoV GII.4 virus-like particles (VLPs) were purchased from The Native Antigen Company, Poly (I:C ...
-
No products found
because this supplier's products are not listed.
Qiulong Yan, et al.,
bioRxiv - Microbiology 2020
Quote:
The DNA and RNA of virus were extracted by using TIANamp Virus DNA / RNA Kit (TIANGEN) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Reza Khayat, et al.,
bioRxiv - Biophysics 2019
Quote:
5 uL of pCV2-2 VLP samples was applied to CF200-CU carbon film 200 mesh copper grids (Electron Microscopy Science) for 1 min and the grids were then washed with 200 µl of 50 mM of Na Cacodylate buffer and then strained immediately with 50 µl of 0.5% uranyl acetate for 1 min ...
-
No products found
because this supplier's products are not listed.
Irina V. Chestakova, et al.,
bioRxiv - Microbiology 2023
Quote:
... and H1N1 virus A/California/07/2009 (Sino Biological) using an arbitrary fluorescence cut-off of 6,000 ...
-
No products found
because this supplier's products are not listed.
Dennis Dienst, et al.,
bioRxiv - Bioengineering 2019
Quote:
... F’ (Sarstedt) using the “Plate Chameleon V Microplate Reader” (Hidex) ...
-
No products found
because this supplier's products are not listed.
Masao Takeuchi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... F(ab’)2 fragment (#4408, Cell Signaling), Alexa Fluor 488 conjugated-anti-rabbit IgG(H+L) ...
-
No products found
because this supplier's products are not listed.
Joshua J. Sims, et al.,
bioRxiv - Genetics 2021
Quote:
... We measured reporter virus transduction activity on a luminometer (BioTek) using the Renilla Glo Kit (Promega ...
-
No products found
because this supplier's products are not listed.
Victoria L. Corbit, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Virus was injected using a syringe pump (Harvard Apparatus) fitted with a syringe (Hamilton ...
-
No products found
because this supplier's products are not listed.
Tomasz M. Grzywa, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-Arg1 (polyclonal, IC5868P/F, R&D Systems), anti-Arg2 (ab137069 ...
-
No products found
because this supplier's products are not listed.
Taivan Batjargal, et al.,
bioRxiv - Systems Biology 2022
Quote:
... 10% fetal bovine serum (Atlas Biologicals, F-0500-D), 1% penicillin and streptomycin at 37°C and 5% carbon dioxide ...
-
No products found
because this supplier's products are not listed.
Corinna Probst, et al.,
bioRxiv - Microbiology 2021
Quote:
Strains were cultivated in either synthetic complete (SC) medium (MP Biomedicals) or YPD at 30°C ...
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rat anti-P2X4 (kind gift of F. Nolte (Universitätsklinikum Hamburg-Eppendorf)) ...
-
No products found
because this supplier's products are not listed.
Linda M. Sircy, et al.,
bioRxiv - Immunology 2023
Quote:
... recombinant HA protein from A/Puerto Rico/8/1934 (H1N1) virus strain (Immune Technology Corp., #IT-003-0010ΔTMp) was biotinylated with 80-fold molar excess of NHS-PEG4-Biotin solution from the EZ-Link™ NHS-PEG4-Biotin kit (ThermoFisher ...
-
No products found
because this supplier's products are not listed.
Ilva Liekniņa, et al.,
bioRxiv - Neuroscience 2023
Quote:
... EPEA-displaying VLPs were first biotinylated using biotin-PEG4-NHS ester (Jena Bioscience, CLK-B103), after which it was immobilised on a 4PCP-STA streptavidin chip to a final density of 58 pg/mm2 ...
-
No products found
because this supplier's products are not listed.
Katherine S. Wetzel, et al.,
bioRxiv - Microbiology 2023
Quote:
... abscessus strains using a spectrophotometer (Tecan, infinite 200 PRO) until stationary phase was reached (2 days for M ...
-
No products found
because this supplier's products are not listed.
David M. Garcia, et al.,
bioRxiv - Molecular Biology 2020
Quote:
Yeast strains were cultured on either YPD agar or liquid (RPI) or SD-Ura (Sunrise Scientific ...
-
No products found
because this supplier's products are not listed.
Nicolas Mateos, et al.,
bioRxiv - Biophysics 2023
Quote:
... We generated VLPs as follows: 57 μL of Trans-IT reagent (Mirus) were added to 2 μg of pR8ΔEnv.2 ...
-
No products found
because this supplier's products are not listed.
Elli Makrydaki, et al.,
bioRxiv - Bioengineering 2022
Quote:
... coli strain AVB101 (Avidity), was used for the isolation of pBirAcm ...
-
No products found
because this supplier's products are not listed.
Matthew Wortham, et al.,
bioRxiv - Physiology 2019
Quote:
... and 0.02% Pluronic F-127 (Biotium) for 45 min at 37°C ...
-
No products found
because this supplier's products are not listed.
Arthur Flohr Svendsen, et al.,
bioRxiv - Cell Biology 2021
Quote:
... Virus was produced by transfecting Platinum-E retroviral packaging cells (Cell Biolabs) according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Jérôme Wahis, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 2 μl 20% Pluronic F-127 in DMSO (Tocris Biosciences), and 1 μl 0.5% Kolliphor EL (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Maxim Rubin-Blum, et al.,
bioRxiv - Microbiology 2023
Quote:
... or on GF/F (Pall) until the filter was clogged (tens to hundreds of ml) ...
-
No products found
because this supplier's products are not listed.
Xintao Qiu, et al.,
bioRxiv - Genomics 2021
Quote:
... diluted in DMEM/F-12 (#36254, Stemcell Technologies) at 37°C for 2 hours ...
-
No products found
because this supplier's products are not listed.
Levin Hafa, et al.,
bioRxiv - Bioengineering 2023
Quote:
... A tube lens (Carl Zeiss, 1x, f= 164.5 mm) was used to create a real intermediate image before the light enters the objective lens ...
-
No products found
because this supplier's products are not listed.
Morgan McSweeney, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Videos of VLPs diffusing in AM were recorded with MetaMorph software (Molecular Devices, Sunnyvale, CA) at a temporal resolution of 66.7 ms ...
-
No products found
because this supplier's products are not listed.
Sophie L. Winter, et al.,
bioRxiv - Microbiology 2022
Quote:
... Purified pHluorin-labelled VLPs were added to a glow-discharged μ-Slide 8 well dish (ibidi) at a protein concentration of 10 ng/μl and were allowed to settle for 20 min at RT ...
-
No products found
because this supplier's products are not listed.
Xiaonan Zhang, et al.,
bioRxiv - Microbiology 2020
Quote:
... The blood samples from enrolled patients were tested for hepatitis B virus surface antigen (HBsAg) and hepatitis B virus e antigen (HBeAg) by Abbott AXSYM HBsAg (normal ...
-
No products found
because this supplier's products are not listed.
Ferdinand Roesch, et al.,
bioRxiv - Microbiology 2022
Quote:
... Virus was diluted in RPMI-1640 (Genesee Scientific) media containing 2% FBS and 10 mM HEPES ...
-
No products found
because this supplier's products are not listed.
J. Cody Herron, et al.,
bioRxiv - Cell Biology 2022
Quote:
Ham’s F-12 (Caisson Labs, UT) supplemented with 2% HI-FBS was used as an imaging medium ...
-
No products found
because this supplier's products are not listed.
Benjamin A. Adler, et al.,
bioRxiv - Microbiology 2022
Quote:
... a strain of dh10b (NEB, Intact Genomics) containing a Cas13-crRNA plasmid (Supplementary Table 2 ...
-
No products found
because this supplier's products are not listed.
Lene Clausen, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... the transformed strain was mated to the yeast gene deletion strain collection by automated pinning (RoToR, Singer Instruments, UK). Selection for diploids ...
-
No products found
Yang Li, et al.,
bioRxiv - Immunology 2021
Quote:
PAOC cells were immortalized with Lenti-hTERT virus (ABM; cat# G200) following manufacturer’s instructions and clonal sorting/expansion ...
-
No products found
because this supplier's products are not listed.
Krishnendu Chakraborty, et al.,
bioRxiv - Immunology 2021
Quote:
... media supplemented with 20 ng/ml VEG-F (Peprotech) until 70-90% confluent ...
-
No products found
because this supplier's products are not listed.
CL Esposito, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1 mM 2’F-Py (2’F-2’-dCTP and 2’F-2’-dUTP, TriLink Biotechnologies), 1 mM ATP ...
-
No products found
because this supplier's products are not listed.
Ellen Van Gulck, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 48h post transfection virus was collected and concentrated with PEG Virus Precipitation Kit (BioVision Inc, USA) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Shiny Amala Priya Rajan, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... F-Actin (Cayman Chemicals), CK-18 (Abcam) ...
-
No products found
because this supplier's products are not listed.
Jessica Devant, Götz Hofhaus, Grant Hansman,
bioRxiv - Microbiology 2019
Quote:
UNSW-2012 and CHDC-1974 VLPs (3 μl) were applied on freshly glow discharged Quantifoil holey carbon support films (R1.2/1.3; Quantifoil) and blotted for 18 seconds at 100% humidity at 10°C before been plunged in liquid ethane using an FEI Mark IV Vitrobot (Thermo Fischer Scientific) ...
-
No products found
because this supplier's products are not listed.
Yingjia Yao, et al.,
bioRxiv - Microbiology 2023
Quote:
... and obtained the S gene fragment of Wuhan-Hu-1 strain (GenBank: MN908947) and Omicron strain (GenBank: OW996240; B.1.1.529) by gene synthesis (GENEWIZ). To establish a lentivirus-based SARS-CoV-2 pseudovirus system ...
-
No products found
because this supplier's products are not listed.
Gulum Altab, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... OGDH F: GGTGTCGTCAATCAGCCTGAGT R: ATCCAGCCAGTGCTTGATGTGC (Origene, UK); PGC1α F ...
-
No products found
because this supplier's products are not listed.
Chisato Ono, et al.,
bioRxiv - Immunology 2023
Quote:
... in the presence of 22.5 μg/ml anti-Fcrl5 F(ab’)2 Biotin or Rat IgG F(ab’)2 Biotin isotype control (Rockland) and 20 μg/ml streptavidin (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Liwen Deng, et al.,
bioRxiv - Microbiology 2019
Quote:
... GBS strains were grown in THB (Hardy Diagnostics) at 37°C ...
-
No products found
because this supplier's products are not listed.
Margaux Aubel, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
... cloni 10G strain (LGC, Biosearch Technologies, Hoddesdon, UK) was used for all the cloning steps and plasmid amplification ...
-
No products found
because this supplier's products are not listed.
Tianyang Mao, Eric Song, Akiko Iwasaki,
bioRxiv - Immunology 2020
Quote:
... 200 µg αPD-1 (clone 29 F.1A12, BioXCell) or 200 µg isotype-matched control antibody (Rat IgG2a ...
-
No products found
because this supplier's products are not listed.
Justin J. Botterill, et al.,
bioRxiv - Neuroscience 2021
Quote:
Virus was delivered using a 500nL Neuros Syringe (#65457-02, Hamilton Company) attached to the stereotaxic apparatus with a probe holder (#751873 ...
-
No products found
because this supplier's products are not listed.
Julia Aresti-Sanz, et al.,
bioRxiv - Microbiology 2020
Quote:
... All bacterial strains were grown in incubators (New Brunswick Scientific) at 37 °C aerobically in in enriched beef broth (S1 Table) ...
-
No products found
because this supplier's products are not listed.
Dan Liu, et al.,
bioRxiv - Genetics 2019
Quote:
... pallidum Nichols strain using Lasergene software (DNASTAR, Madison, WI, USA).
-
No products found
Svenja Fritzlar, et al.,
bioRxiv - Microbiology 2023
Quote:
... virus was activated by adding 8μg/mL trypsin (TPCK treated, Worthington, Lakewood, NJ) in FCS-free media to samples in a 1:1 ratio ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, et al.,
bioRxiv - Neuroscience 2023
Quote:
... or bisphenol F (BPF; #A11471, Alfa Aesar, ≥98 %) in 10 mL of corn oil (#405435000 ...