Labshake search
Citations for Origene Technologies :
1 - 7 of 7 citations for Rubella Virus VLP strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... OGDH F: GGTGTCGTCAATCAGCCTGAGT R: ATCCAGCCAGTGCTTGATGTGC (Origene, UK); PGC1α F ...
-
bioRxiv - Cell Biology 2021Quote: ... virus particle containing supernatant was collected and enriched using LentiConcentrator (OriGene). Cells were transduced with the respective concentrated virus particles using 10 µg/mL polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... virus-containing supernatant was collected and concentrated using Lenti-Concentrator (OriGene), for minimum 2h at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... LILRB5 and OTOR carried out using virus particles obtained from OriGene (Rockville, MD). Virus transduction were carried out at 5.0 MOI using polybrene ...
-
bioRxiv - Neuroscience 2020Quote: B2M was knocked down using lentiviral particles containing B2M-targeting shRNA (OriGene, TL314543V, Virus A). Non-targeting scramble shRNA from the same kit was used as control ...
-
bioRxiv - Neuroscience 2023Quote: ... Each virus expressed the full-length sequence for either mouse Elp1 (Origene MC202501, NM 026079) or human ELP1 (Origene RC2076868) ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-2 (55aa, YP_009137225.1), and B-virus (56aa, NP_851932) were synthesized and cloned in pCMV6-Entry vector by Origene custom service ...