-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
No products found
because this supplier's products are not listed.
Tania Ray, et al.,
bioRxiv - Cell Biology 2020
Quote:
... transfected cells were placed in Rat MSC medium (Rat MSC growth medium kit, Cell Applications, Inc.) and incubated for 14 days in incubator (37°C ...
-
No products found
because this supplier's products are not listed.
Faith C.J. Davies, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and UBC (5’ AGCCCAGTGTTACCACCAAG and 5’ ACCCAAGAACAAGCACAAGG) were selected as suitable reference genes after analysis with a geNorm 6 gene mouse kit (PrimerDesign). Brilliant II SYBR Green QPCR master mix (Agilent ...
-
No products found
because this supplier's products are not listed.
Haeyoung Kim, et al.,
bioRxiv - Cell Biology 2022
Quote:
The expression of EWSR1-mCherry and EWSR1:R565A-mCherry proteins were confirmed by immunocytochemistry using rat anti-RFP (1:1000 dilution) (Bulldog Bio Inc, #RMA5F8) followed by anti-Rat Alexa Fluor 568 (1:500 dilution ...
-
No products found
because this supplier's products are not listed.
Ennio d’Amico, et al.,
bioRxiv - Biochemistry 2022
Quote:
The following Dynactin coding genes were codon-optimized for protein expression in insect cells and synthesized (Epoch Life Science): DCTN1 (Protein name p150 ...
-
No products found
because this supplier's products are not listed.
Danya Abazari, et al.,
bioRxiv - Neuroscience 2022
Quote:
Protein palmitoylation assay was performed using CAPTUREome S-palmitoylated protein kit (Badrilla, Leeds, UK), as described by manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
E.E. Van Haaften, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the supernatants were consecutively incubated with antibody-conjugated MagPlex microspheres (1 h), biotinylated antibodies (1 h), and streptavidin-phycoerythrin (10 min, diluted in high performance ELISA (HPE) buffer (Sanquin)) ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Soumitra Ghosh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
All-in-one lentiviral vectors encoding both the RNA guide (gRNA) and the Cas9 protein for AR gene deletion were obtained from Applied Biological Materials Inc ...
-
No products found
because this supplier's products are not listed.
Drake M. Mellott, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Enrichment of alkyne-modified proteins was conducted using the Click-&-Go Protein Enrichment Kit (Click Chemistry Tools) and the protocols thereof ...
-
No products found
because this supplier's products are not listed.
Petra Kangas, et al.,
bioRxiv - Cell Biology 2022
Quote:
... For depletion of the most abundant proteins from CSF ProteoSpin Abundant Serum Protein depletion kit (Norgen Biotek) was used according to manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Hajera Amatullah, et al.,
bioRxiv - Immunology 2021
Quote:
... nuclei were isolated from 100,000 primary human macrophages and bound to activated magnetic concanavalin A beads (Epicypher). The bound nuclei were incubated with primary antibody overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Samantha C. Lauby, et al.,
bioRxiv - Neuroscience 2020
Quote:
... liver DNA from the F1 rat mothers was extracted using an EZNA Tissue DNA extraction kit (Omega Bio-tek, Norcross, GA) and assessed for SNPs in genes relevant to maternal behavior ...
-
With the RapidClean protein removal kit, completely remove protein from aqueous solutions of...
Cat# K-01001-010,
10 reactions, USD $145.00/ea
Ask
Ramesh Koirala, et al.,
bioRxiv - Biophysics 2021
Quote:
... Protein samples were detected with a WesternBright Chemiluminescence Kit (catalog no. K-12045; Advansta). Images were acquired using Image Lab software from Bio-Rad.
-
No products found
because this supplier's products are not listed.
Chi Wang, et al.,
bioRxiv - Biophysics 2022
Quote:
A 3 µl aliquot of freshly concentrated or thawed protein at ∼1 mg/ml was deposited on an UltraAuFoil 300 mesh R 0.6/1 grid (Quantifoil Inc., UK) at 4 °C and 100% humidity in a Vitrobot Mark IV robot (Thermo Fisher) ...
-
No products found
because this supplier's products are not listed.
Jue Wang, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A sample containing 1-20µg of protein was loaded into a 4-15% precast gel (Bio-Rad Mini-ProTEAN) and run at 60V for 20min followed by 160V for 1 hour ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Rahul Kumar, et al.,
bioRxiv - Cell Biology 2023
Quote:
... T7-RILP proteins were expressed in Escherichia coli BL21 (500 μM isopropyl β-d-1-thiogalactopyranoside; Wisent Bioproducts; at room temperature for 16 hours) and purified using standard procedure in tris buffer [20 mM tris (pH 7.4) ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Madeleine F. Jennewein, et al.,
bioRxiv - Immunology 2021
Quote:
... and H3 HK proteins (H3ΔTM H3N2 A/Hong Kong/4801/2014) expressed in 293 cells were purchased from Immune Technology Corp ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Bryana N. Harris, et al.,
bioRxiv - Systems Biology 2022
Quote:
Cardiac myocytes were isolated from 1-2-day-old Sprague-Dawley rats using a Neomyt isolation kit (Cellutron, USA). The cells were cultured in plating media (low-glucose Dulbecco’s modified eagle media (DMEM) ...
-
No products found
because this supplier's products are not listed.
Shintaro Maeda, Chinatsu Otomo, Takanori Otomo,
bioRxiv - Cell Biology 2019
Quote:
... and 1% 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate (DiD) (Marker Gene Technologies)) as indicated in Fig ...
-
No products found
because this supplier's products are not listed.
Vikram Jakkamsetti, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Gene enrichment analysis (GEA) was conducted using EnrichR (Kuleshov et al. ...
-
No products found
because this supplier's products are not listed.
Liudmila Sosulina, et al.,
bioRxiv - Neuroscience 2020
Quote:
... the rats were anesthetized with 1% isoflurane in oxygen using an isoflurane vaporizer (Kent Scientific, USA) and fixed with the metal bar to a holder in order to allow stable imaging.
-
No products found
because this supplier's products are not listed.
Chima V. Maduka, et al.,
bioRxiv - Bioengineering 2022
Quote:
Macrophages were detached from 96-well plates after incubation using 1X PBS with 4mM EDTA (Teknova) at 37 °C for 10 minutes ...
-
No products found
because this supplier's products are not listed.
H. Theobald, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell classification to detect alveolar macrophages and other mononuclear phagocytes was performed in CODEX MAV (Akoya Biosciences), following a similar gating scheme as the one used for flow cytometry.
-
No products found
because this supplier's products are not listed.
Leslie E. Lupien, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... human DiI-VLDLs (1 mg protein/mL; Alfa Aesar Chemicals), LPL from bovine milk (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
Yuanzhong Zhang, et al.,
bioRxiv - Biophysics 2023
Quote:
... SARS-CoV-2 envelope protein antibody (ProSci; 9169; 1:1000), SARS-CoV-2 Nucleocapsid protein (RayBiotech ...
-
No products found
because this supplier's products are not listed.
Bruno A. Duso, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... human anti-centromere protein (Antibodies Incorporated, 15-234; 1:1000), rabbit anti-phospho-histone H3(Ser10 ...
-
No products found
because this supplier's products are not listed.
Barnabe D. Assogba, et al.,
bioRxiv - Cell Biology 2022
Quote:
... was used to translate gene sequences and MEGALIGN (DNAStar) to align sequences ...
-
No products found
because this supplier's products are not listed.
Shweta Mendiratta, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... The cells were incubated with 125 nM of each probeset (one for histone genes and second one for a control gene FOS in the Stellaris RNA FISH Hybridization Buffer (Biosearch Technologies; SMF-HB1-10) overnight at 37°C in humified chamber ...
-
No products found
because this supplier's products are not listed.
Stefan E. Spirig, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and the pHGT1-Adeno1 helper plasmid carrying adenoviral genes (kindly provided by C. Cepko, Harvard Medical School, Boston, USA) using PEIMAX (Polyscience, #POL24765-1). Plasmids were mixed in 98 mL DMEM (Thermo Fischer ...
-
No products found
because this supplier's products are not listed.
Justin A. Jarrell, et al.,
bioRxiv - Bioengineering 2019
Quote:
... each sample was mixed in a 1.5mL tube with the appropriate volume of EGFP mRNA (996 nucleotides translated into a 26.9 kDa protein, 1 mg mL−1 L-7601, TriLink BioTechnologies) at final concentrations ranging from 10 μg mL−1 to 160 μg mL−1 (30 nM to 473 nM) ...
-
No products found
because this supplier's products are not listed.
Jonathan T. Lloyd, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 66 were reproduced in hanging drops (1 μL protein solution plus 1 μL mother liquor) using 24-well VDX plates (Hampton Research) containing 500 μL mother liquor in the reservoir ...
-
No products found
because this supplier's products are not listed.
Laura E. Griffin, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... rats were transitioned to the purified AIN-93G Growing Rodent Diet (D10012G) from Research Diets Inc ...
-
WB,ELISA
Cat# A5370, SKU# A5370-20ul,
20ul, $47.00
Ask
Shang-Kun Dai, et al.,
bioRxiv - Genomics 2021
Quote:
Total proteins were extracted using the RIPA lysis buffer (Beyotime Biotechnology, Shanghai, China) containing 1×complete proteinase inhibitor (Bimake), and protein concentration was defined using BCA protein assay kit (Beyotime) ...
-
No products found
because this supplier's products are not listed.
Richard J. Burt, et al.,
bioRxiv - Cancer Biology 2023
Quote:
A double-stranded RNA ELISA kit (Exalpha/Nordic Mubio) was used to quantify dsRNA from 1ug of total RNA ...
-
No products found
because this supplier's products are not listed.
Jeremy Rich, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... visualized using the polink anti rat kit (GBI Labs) and the peroxidase/diaminobenzidine Rabbit PowerVision kit (ImmunoVision Technologies) ...
-
No products found
because this supplier's products are not listed.
Daria A. Egorova, et al.,
bioRxiv - Microbiology 2022
Quote:
... Total protein quantity was measured with QuDye Protein kit (Lumiprobe) on Qubit fluorometer (ThermoScientific).
-
No products found
because this supplier's products are not listed.
Ana Bura, Antonija Jurak Begonja,
bioRxiv - Cell Biology 2022
Quote:
... monoclonal rat anti-GPIbβ (M050-1) was from Emfret Analytics, rabbit anti-β1 tubulin was a kind gift of dr ...
-
No products found
because this supplier's products are not listed.
Paul Batty, et al.,
bioRxiv - Cell Biology 2023
Quote:
... NIPBL was detected using a rat monoclonal antibody (Absea, 010702F01, 1:500). Sororin was detected using a custom rabbit antibody (1:500) ...
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Benedikt Graf von Armansperg, et al.,
bioRxiv - Microbiology 2020
Quote:
Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
No products found
because this supplier's products are not listed.
Caroline S. Simon, et al.,
bioRxiv - Cell Biology 2021
Quote:
... and anti-rat-Atto594 (Biomol) were all used at a 1:200 dilution ...
-
No products found
because this supplier's products are not listed.
Xin Zhang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... goat anti-rat IgG coupled to 1.4 nm gold 1:300 (Nanogold, Nanoprobes, Yaphank, NY, USA) in blocking solution followed the procedures as previously described [47] ...
-
No products found
because this supplier's products are not listed.
Katharina Braunger, et al.,
bioRxiv - Immunology 2021
Quote:
... rat and guinea pig serum were from Complement Technology.
-
No products found
because this supplier's products are not listed.
Kongyan Li, et al.,
bioRxiv - Neuroscience 2021
Quote:
... These were placed inside the ear canals of the rat and served to fix the rat into a stereotaxic frame (RWD Life Sciences, China). The earphone assemblies were calibrated using a G.R.A.S ...
-
No products found
because this supplier's products are not listed.
Alan Wanke, et al.,
bioRxiv - Plant Biology 2023
Quote:
Carbohydrate digestion assays were performed using either purified barley GBP (heterologously expressed in N. benthamiana) or barley BGLUII (Chandrasekar et al., 2022; available from Megazyme, E-LAMHV). Preparations of the fungal CW and EPS matrix were incubated overnight in sterile MilliQ water at 65°C prior to enzymatic digestion ...
-
No products found
because this supplier's products are not listed.
Adam R. Denton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Brains were sliced on a standard rat brain matrix (Ted Pella, Inc., Redding, CA) at a thickness of 500 μm.