Labshake search
Citations for Euromedex :
1 - 50 of 81 citations for Rat Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: Protein-protein interactions were detected using the bacteria adenylate cyclase two-hybrid system kit (Euromedex) according to product manuals (Karimova et al. ...
-
bioRxiv - Microbiology 2021Quote: Gene encoding TurboFP650 was amplified from the plasmid pTurboFP650-N (Evrogen, Euromedex, France) with primers TurboFP650-XbaI 5’TGCTCTTAGATTTAAGAAGGAGATATAGATATGGGAGAGGATAGCGAGCTG3’ and TurboFP650-SphI 5’CATGCATGCTTAGCTGTGCCCCAGTTTGCTAGG3’ ...
-
bioRxiv - Microbiology 2023Quote: Protein-protein interactions were evaluated using the Bacterial Two Hybrid System (Euromedex) according to the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were loaded on 10% SDS-PAGE gels in parallel with a protein prestained ladder (Euromedex) and transferred onto PVDF membranes (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Protein expression was induced using 40 μM IPTG (Euromedex) and carried out overnight at 18°C ...
-
bioRxiv - Microbiology 2022Quote: ... the commercially available bacterial two-hybrid kit (BATCH kit, Euromedex) was used [8 ...
-
bioRxiv - Neuroscience 2024Quote: ... Molecular weight were checked using a Prestained Protein Ladder (#06P-0111, Euromedex).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®), 20%EtOH transfer buffer at 100 V for 1h ...
-
bioRxiv - Microbiology 2023Quote: Interactions between proteins of interest were screened using the BACTH bacterial two-hybrid system (Euromedex) as described by Karimova et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were separated by migration at 135 V in 1X Tris-Glycine-SDS buffer (Euromedex). Proteins were electro-transferred on a nitrocellulose membrane in 1X Tris-Glycine buffer supplemented with 20% ethanol ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 g.L−1 5-FOA (Euromedex) or 0.06 g.L−1 canavanine (Sigma ...
-
bioRxiv - Microbiology 2019Quote: Bacterial two-hybrid assays were conducted using the BACTH System kit (bacterial adenylate cyclase two-hybrid system kit, Euromedex). The P ...
-
bioRxiv - Microbiology 2020Quote: ... 1% BSA (Euromedex), 1mM EDTA (GIBCO) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1:200 (Euromedex), TFE3 ...
-
bioRxiv - Microbiology 2020Quote: Proteins were fractionated by performing SDS-PAGE (12% except where indicated) stained with Coomassie blue (Euromedex, Souffelweyrshim, France). For immunoblot analysis ...
-
bioRxiv - Microbiology 2020Quote: Combinations of the above T18 and T25 fusion proteins were transformed into the BACTH compatible strain BTH101 (Euromedex) for analysis ...
-
bioRxiv - Systems Biology 2023Quote: ... The strains were grown in liquid SC medium (Yeast Nitrogen Base with ammonium sulfate 6.7 g.l−1, MPbio, OH, USA; amino acid mixture 2 g.l−1, MPbio; glucose 20 g.l−1, Euromedex, France). The culture was maintained until the strains reached their growth mid log phase using an optical plate reader (Tecan infinite F200 pro) ...
-
bioRxiv - Microbiology 2021Quote: ... and pKNT25 from the BACTH System Kit (Euromedex) using XbaI and KpnI ...
-
bioRxiv - Microbiology 2023Quote: ... the commercially available BACTH kit was used (Euromedex). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 1h in 37°C and proteins were then digested with Proteinase K (Euromedex, final concentration 0.4 mg/ml) for 2h at 37°C and the temperature was then shifted to 65°C overnight to reverse cross-links ...
-
bioRxiv - Microbiology 2020Quote: ... 100 mM NaCl and 1% CHAPS (3-[(3-cholamidopropyl) diméthylammonio]-1-propanesulfonate (Euromedex). The supernatant was cleared by centrifugation at 53 000 g for 30 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% deoxycholate Na, 0.1% SDS, 1 mM AEBSF [Euromedex] and cOmplete EDTA-free [Roche]) with glass beads (diameter ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples migrated on 7.5% (for proteins over 200kDa) or 10% SDS-PAGE polyacrylamide gel at 140V with 1xTris-Glycine SDS running buffer (Euromedex®). Proteins were transferred on nitrocellulose membrane 0.45 μm in 1xTris-Glycine (Euromedex®) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 20 g.L−1 agar (Euromedex), 10 g.L−1 peptone (Euromedex ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 g.L−1 peptone (Euromedex) and 10 g.L−1 yeast extraction (Euromedex) ...
-
bioRxiv - Microbiology 2022Quote: ... Equal amounts of GST or GST-Trim69 proteins were then bound to 10 μg of pure porcine brain tubulin (purchased from Euromedex, cat. CS-T240-A) in a total volume of 40 μl of PEM buffer supplemented with 40 μM of Taxol and 1mM GTP ...
-
bioRxiv - Microbiology 2021Quote: The Bacterial Adenylate Cyclase Two-Hybrid System (BACTH System Kit, Euromedex, France) was used to analyze protein–protein interactions ...
-
bioRxiv - Pathology 2021Quote: Total RNA was extracted using the TRI-Reagent kit (Euromedex, Soufflweyersheim, France) and reverse transcription (RT ...
-
bioRxiv - Cell Biology 2020Quote: ... and saturated with PBS BSA 1% (Euromedex) for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-GFP (1:1000; 2A3, Euromedex) rabbit anti-Calnexin (1:1000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 10 g.L−1 yeast extraction (Euromedex). The 5-FOA and CAN plates contained 20 g.L−1 glucose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.79 g.L−1 complete supplement mixture (Euromedex) and 1 g.L−1 5-FOA (Euromedex ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% Triton X-100 (Euromedex, 2000-A), 1.5 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.1% Tween-20) containing 4% dehydrated half-creamed milk, and incubated (overnight, 4°C) rabbit anti-MFGE8 (1/1000, Euromedex), then with anti-mouse horseradish peroxidase-conjugated antibodies (1/3000 ...
-
bioRxiv - Immunology 2021Quote: ... Cells were cross-linked with 1% formaldehyde (Euromedex) for 8 minutes at room temperature and the reaction quenched in 150mM glycine for 10 minutes ...
-
bioRxiv - Bioengineering 2022Quote: ... rifampicin (60 μg.mL−1, EUROMEDEX, 1059, Souffelweyersheim, France), penicillin (50 units.mL−1 ...
-
bioRxiv - Physiology 2021Quote: ... and DAPI (1 μg/μL, 10-50A, Euromedex), sections were washed ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit polyclonal anti-Hec1pS55 (Euromedex, GTX70017, 1:100), rabbit polyclonal anti-Mad2 (1:100 ...
-
bioRxiv - Microbiology 2019Quote: ... BACTH plasmids were made using the Euromedex BACTH System Kit (Euromedex Cat. No. EUK001).
-
bioRxiv - Microbiology 2019Quote: ... Yeasts were washed once in SPM buffer and incubated for 1 h at 30°C in 1 mL of a solution containing 2 mg of Zymolyase 20T (Euromedex®), 100 mg of lysing enzymes from Trichoderma harzianum (Sigma ...
-
Paracrine signalling between intestinal epithelial and tumour cells induces a regenerative programmebioRxiv - Cancer Biology 2021Quote: ... Organoids were then washed with PBS for 3 times for 5 min each and stored in 1:1 ratio PBS and glycerol (Euromedex 15710) before imaging ...
-
bioRxiv - Immunology 2023Quote: ... and purified Tregs at a ratio 1:1 in 96-well plates pre-coated with gelatin-based coating solution (from Cell Biologics, Euromedex).
-
bioRxiv - Molecular Biology 2020Quote: ... and the appropriate selection antibiotics (Euromedex, Supplementary Table 1). For seeding NIH/3T3 cells on coverslips ...
-
bioRxiv - Cell Biology 2022Quote: ... and mouse anti-actin (1:5000; ACT-2D7, Euromedex).
-
bioRxiv - Microbiology 2020Quote: ... 1mM of isopropyl ß-D-1-thiogalactopyranoside (IPTG, EuroMedex) was added to agarose pads or culture media.
-
bioRxiv - Immunology 2020Quote: ... polyclonal rabbit anti-calnexin antibody (1:1000; Euromedex, Souffelweyersheim, France), β–actin (W16197A ...
-
bioRxiv - Cell Biology 2020Quote: ... Freshly-made solution of 20% acrylamide 37.5/1 bisacrylamide (Euromedex) in MiliQ water ...
-
bioRxiv - Cell Biology 2021Quote: ... mESC cells were crosslinked in 1% formaldehyde (Euromedex, #EM-15686) for 15 min at room temperature and quenched with 0,12 M glycine provided in the kit ...
-
bioRxiv - Genomics 2023Quote: ... 50 mL of culture was fixed in 1% formaldehyde (Euromedex), quenched with glycine ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were labelled with 1 µM DAPI (Euromedex, 1050-A) alone ...