-
No products found
because this supplier's products are not listed.
Sarah A. White, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Secreted insulin and insulin content were measured by radioimmunoassay (Rat insulin RIA Kit, Cedarlane, Burlington, ON, CA) or using the Mouse Ultrasensitive Insulin ELISA kit (ALPCO ...
-
No products found
because this supplier's products are not listed.
Kai Xia, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Testosterone levels were measured using a chemiluminescent immunoassay (CLIA) system (Architect system; Abbott GmbH & Co. KG, Germany). The coefficient of variation of this CLIA system is 1.9–5.1% for intra-assay precision and 2.5–5.2% for inter- assay precision ...
-
No products found
because this supplier's products are not listed.
Yu-Jue Li, Qi Guo, Wen-Feng Xiao, Ye Xiao,
bioRxiv - Molecular Biology 2023
Quote:
... The tube-like structures were imaged by Inverted Microscope Camera System (Leica) and calculated automatically using the ImageJ software.
-
No products found
because this supplier's products are not listed.
Shaima Al-Khabouri, et al.,
bioRxiv - Immunology 2021
Quote:
... and lysed using 29G insulin syringes (VWR). Lysed cells were then stored at −80°C prior to RNA purification ...
-
No products found
because this supplier's products are not listed.
Junhua Yang, et al.,
bioRxiv - Physiology 2020
Quote:
... Insulin level in each plasma sample was measured using a Rat Insulin ELISA Kit (Elabscience, Wuhan, China)
-
No products found
because this supplier's products are not listed.
Francisco Santos, et al.,
bioRxiv - Cell Biology 2024
Quote:
... insulin and FGF (Promocell)] ...
-
No products found
because this supplier's products are not listed.
Antonio P. A. Ferreira, et al.,
bioRxiv - Cell Biology 2020
Quote:
... 0.8μM Insulin (MP Biomedicals 0219390025), 10ng/mL Basic Fibroblast Growth Factor (bFGF ...
-
No products found
because this supplier's products are not listed.
Shuhei Murase, et al.,
bioRxiv - Bioengineering 2022
Quote:
Rat RVLM sections were stained using a TUNEL kit (Biotium, Fremont, CA) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Rishi Drolia, et al.,
bioRxiv - Microbiology 2023
Quote:
... that inhibits caveolae-like membrane domains or the synthetic glycosphingolipid L-t-LacCer (β-d-lactosyl-N-octanoyl-l-threo-sphingosine; 5 µM, Avanti Polar Lipids) that blocks caveolar endocytosis without some of the off-target effects of MβCD (37 ...
-
No products found
because this supplier's products are not listed.
Ramile Dilshat, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
Insulin ELISA / assay Kit
Cat# K046-H1,
1.0 ea, USD $455.0
Ask
Diana Gataulin, et al.,
bioRxiv - Physiology 2022
Quote:
Corticosterone was measured 5 h after the dark cycle begun using the DetectX Corticosterone CLIA kit (Arbor assays). 5μl tail blood samples from mice were collected before (basal) ...
-
No products found
because this supplier's products are not listed.
Kun Pang, Song bo Zhu, Liqiang Han,
bioRxiv - Physiology 2019
Quote:
... Plasma insulin concentrations were quantified using a Mouse Insulin Ultra-sensitive ELISA Kit (BC1710, Solarbio). For ITTs ...
-
No products found
because this supplier's products are not listed.
Lukasz Chrobok, et al.,
bioRxiv - Neuroscience 2021
Quote:
... glucagon-like peptide 1 (GLP-1; 1µM, Bachem), 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX ...
-
No products found
because this supplier's products are not listed.
Luiselys M. Hernandez, et al.,
bioRxiv - Neuroscience 2020
Quote:
... ShRNA sequences against rat Zdhhc3 (5’-GAGACATTGAACGGAAACCAGAATACCTC-3’) and Zdhhc7 (5’-ATGACATGGCTTCTGGTCGTCTATGCAGA-3’) were purchased from Origene and subcloned ...
-
No products found
because this supplier's products are not listed.
Loredana Leggio, et al.,
bioRxiv - Neuroscience 2021
Quote:
... or rat-anti-CD63 (MBL, D263-3)) in 0.1% BSAc (Electron Microscopy Sciences) for 1 h ...
-
No products found
because this supplier's products are not listed.
Joseph M Gibbons, et al.,
bioRxiv - Microbiology 2019
Quote:
... Virus-like particles (VLPs) were produced by linear polyethylenimine 25K (Polysciences) transfection of HEK-293T ...
-
No products found
because this supplier's products are not listed.
Coralie Hérent, et al.,
bioRxiv - Neuroscience 2021
Quote:
Instantaneous respiratory-like frequencies were analyzed offline using the threshold search in Clampfit (Molecular Devices) before ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jhon R. Enterina, et al.,
bioRxiv - Immunology 2021
Quote:
... anti-rat IgG2a-AF488 (SouthernBiotech), and anti-rat IgG2b-AF647 (BioLegend) ...
-
No products found
because this supplier's products are not listed.
Aileen A. Nava, et al.,
bioRxiv - Genetics 2023
Quote:
... The macros’ algorithm then performs the same tasks as commercially available quantification software like Image Studio Lite from LI-COR Biosciences 174 ...
-
Lower in secondary proteolytic contaminant activities but with typical collagenase activity. ...
Cat# LS004185,
Bulk, Inquire
Ask
Harold P. Hodgins, et al.,
bioRxiv - Genomics 2022
Quote:
Primary rat cortical neurons were prepared from E18-19 embryos using a papain dissociation kit (Worthington Biochemical) following the manufacturer’s instruction ...
-
No products found
because this supplier's products are not listed.
Xi Chen, et al.,
bioRxiv - Bioengineering 2021
Quote:
PC12 cell or rat liver gDNAs was isolated using the TIANamp blood DNA kit (TIANGEN Biotech, DP304-02) following the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Jiao Wang, et al.,
bioRxiv - Immunology 2020
Quote:
... rat tail was purchased from Enzo Life Sciences, Inc ...
-
No products found
because this supplier's products are not listed.
Gabriele Liuzzi, Antonello Mallamaci,
bioRxiv - Developmental Biology 2023
Quote:
- αMecP2 (rat polyclonal IgG2a serotype, Active Motif #61291), 3 μg/reaction.
-
No products found
because this supplier's products are not listed.
Claudia Bartoli, et al.,
bioRxiv - Pathology 2022
Quote:
... library was prepared using the EXP-NBD103 and SQK-LSK108 kits according to the manufacturer’s instructions and starting with 3 μg of 20 kb sheared DNA (Megaruptor, Diagenode) as input ...
-
No products found
because this supplier's products are not listed.
Yi-Ling Lu, Helen E. Scharfman,
bioRxiv - Neuroscience 2021
Quote:
... and an “interface-like” submerged-style chamber (interface-like chamber, RC-27LD, Harvard Apparatus, Figure 1B). When slices were placed in the recording chamber ...
-
No products found
because this supplier's products are not listed.
Christian W. Johnson, et al.,
bioRxiv - Biochemistry 2021
Quote:
... GFP/Venus (MBL International, rat monoclonal, cat. # D153-3), GFP/Venus (Roche ...
-
No products found
because this supplier's products are not listed.
VA Brentville, et al.,
bioRxiv - Immunology 2023
Quote:
Murine and rat ELISpot kits (Mabtech) were used with 5×105 splenocytes/well in RPMI with L-glutamine ...
-
No products found
because this supplier's products are not listed.
Tania Ray, et al.,
bioRxiv - Cell Biology 2020
Quote:
... transfected cells were placed in Rat MSC medium (Rat MSC growth medium kit, Cell Applications, Inc.) and incubated for 14 days in incubator (37°C ...
-
No products found
because this supplier's products are not listed.
Nicholas B. Chamberlain, Ted Hackstadt,
bioRxiv - Microbiology 2022
Quote:
HeLa 229 human cervical epithelial-like cells (American Type Culture Collection) were cultivated in RPMI-1640 (Gibco ...
-
No products found
because this supplier's products are not listed.
Evyatar Swissa, et al.,
bioRxiv - Neuroscience 2023
Quote:
... using the Rat Albumin ELISA kit (Bethyl Laboratories, TX, USA) according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Katarina Bartalska, et al.,
bioRxiv - Neuroscience 2022
Quote:
... were coated for retinal organoid or microglia-like differentiation and 2-well chambered coverslips (Ibidi, #80286) for 2.5D culture.
-
No products found
because this supplier's products are not listed.
Rory Henderson, et al.,
bioRxiv - Immunology 2023
Quote:
... The synthetic Toll-like receptor 7/8 agonist 3M-052 absorbed to ALUM (3M-052-ALUM) was used as the adjuvant for the vaccine immunogens ...
-
No products found
because this supplier's products are not listed.
Yahaya A. Yabo, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... an Opal 3-Plex Manual Detection Kit (Akoya Biosciences) was used following the manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Jamie A. Havrilak, et al.,
bioRxiv - Neuroscience 2019
Quote:
NvLWamide-like::mCherry tripolar and longitudinal neurons were counted on live animals under a dissection microscope (Nikon SMZ1270), on live animals placed under a slide with a raised coverslip on a compound microscope (Nikon NTi) ...
-
No products found
because this supplier's products are not listed.
Frederic Li Mow Chee, et al.,
bioRxiv - Cell Biology 2021
Quote:
... were resuspended in 2–3 mg/ml rat-tail collagen I in RM+ medium and seeded on 23-mm FluoroDish cell culture dishes (World Precision Instruments). The collagen with embedded cells was allowed to set at 37°C until collagen contraction was observed (∼30 min) ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
José Luis Marín-Rubio, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... using a Gemini C18 column (250 mm × 3 mm, 3 μm, 110 Å; Phenomenex). Buffer A consisted of 20 mM ammonium formate pH 8.0 and Buffer B of 100% acetonitrile ...
-
No products found
because this supplier's products are not listed.
Jaclyn A. Wisinski, et al.,
bioRxiv - Physiology 2021
Quote:
... Anti-insulin antibodies (Insulin + Proinsulin Antibody, 10R-I136a; Insulin + Proinsulin Antibody, biotinylated, 61E-I136bBT) were from Fitzgerald Industries (Acton ...
-
No products found
because this supplier's products are not listed.
Sumeet Pal Singh, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Dako A0564)/insulin (rabbit, Genetex 128490) at 1:200 ...
-
No products found
because this supplier's products are not listed.
Kirsty R. Erickson, et al.,
bioRxiv - Neuroscience 2022
Quote:
Anxiety-like phenotypes were assessed in an elevated zero maze (Stoelting: 50cm inner diameter ...
-
Cat# HY-P70176-50 μg,
50 μg, USD $330.0
Ask
Zhe Weng, et al.,
bioRxiv - Genomics 2021
Quote:
... 0.01mg/ml insulin (HY-P1156, MedChemExpress), and 1% penicillin-streptomysin (Gibco ...
-
No products found
because this supplier's products are not listed.
Kristina Vaeth, et al.,
bioRxiv - Biochemistry 2021
Quote:
... anti-rat-HRP (Dianova). All strains and plasmids used in this study are listed in Suppl ...
-
No products found
because this supplier's products are not listed.
Emily A. Rex, et al.,
bioRxiv - Microbiology 2023
Quote:
... IP of total SUMOylated protein fractions used either SUMO-1 or SUMO-2/3 Ab included with the Signal Seeker SUMOylation 1 or 2/3 Detection Kit (Cytoskeleton) and IPs were carried out according to the manufacturer instructions ...
-
No products found
because this supplier's products are not listed.
Ekin Guney, et al.,
bioRxiv - Physiology 2020
Quote:
... p-Insulin Receptor Antibody(p-Thy1162/1163) (Calbiochem 407707 or Sigma I1783), phospho-CaM KinaseII (Cell Signaling #12716) ...
-
No products found
because this supplier's products are not listed.
Alexander Belyy, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 3’-deoxyadenosine-5’-triphosphate (3’-dATP, Jena Bioscience) at 2 mM and MgCl2 at 4 mM was incubated for 15 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Kaitlyn Bacon, et al.,
bioRxiv - Bioengineering 2019
Quote:
... 3 kDa MWCO concentrator (Sartorius), and the protein concentration was estimated using a BCA assay.
-
No products found
because this supplier's products are not listed.
Matthew G. Zimmerman, et al.,
bioRxiv - Microbiology 2019
Quote:
... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
No products found
because this supplier's products are not listed.
Allen K. Kim, Helen D. Wu, Takanari Inoue,
bioRxiv - Cell Biology 2020
Quote:
... filter wheels (Lambda 10-3, Sutter Instruments), and LED light source (pE-300 ...