-
No products found
because this supplier's products are not listed.
Miglė Kišonaitė, et al.,
bioRxiv - Biochemistry 2021
Quote:
... Boc-L-R-R-AMC (trypsin-like activity) and Z-L-L-E-AMC (caspase-like activity) (Boston Biochem). The proteasome samples were incubated with 50 μM AMC-peptide in the respective purification buffers (standard or the exogenous nucleotide depleted buffer ...
-
No products found
because this supplier's products are not listed.
Laura Schenkel, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 5 the GFP-Like (Em 520/35) and DsRed-like (Em 617/73) Emission Filter Wheels and 2x Evolve 512 cameras (Photometrics; Tucson, Arizona, United States) were used ...
-
No products found
because this supplier's products are not listed.
Yingying Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rabbit anti-immunoglobulin like domain containing receptor 1 (ILDR1) (Antibodies-online.com, 1:200, Cat # ABIN1386369), (6 ...
-
No products found
because this supplier's products are not listed.
Masahide Sakabe, et al.,
bioRxiv - Developmental Biology 2021
Quote:
Neonatal rat cardiomyocyte culture was performed using the neonatal cardiomyocyte isolation kit (Cellutron). P2 neonatal cardiomyocytes were plated on tissue culture dishes pre-coated with SureCoat (Cellutron ...
-
No products found
because this supplier's products are not listed.
Liang-Fu Chen, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... and 5ug/ml bovine insulin (Gemini Bio-Products, 700-112P). After 7-8 days ...
-
No products found
because this supplier's products are not listed.
Belinda Liu, et al.,
bioRxiv - Biochemistry 2019
Quote:
... or the insulin receptor signal peptide were synthesized by Eton Biosciences. Similarly ...
-
No products found
because this supplier's products are not listed.
Johann Holzmann, et al.,
bioRxiv - Cell Biology 2019
Quote:
... rat anti-NIPBL (Absea 010702F01), mouse anti-tubulin (Sigma ...
-
No products found
because this supplier's products are not listed.
Maria Llamazares Prada, et al.,
bioRxiv - Cell Biology 2023
Quote:
The human AT2-like cell line A549 (CCL-185, ATCC) was grown in Ham’s F12 medium (PAN Biotech, P04-14550) supplemented with 10% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
Hsiu-Chuan Lin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... co-cultured with rat cortical astrocytes (Genlantis) on PLO/LMN-coated 8-well or 96-well polymer coverslips (µ-Slide ibiTreat ...
-
No products found
because this supplier's products are not listed.
Bas W.A. Bögels, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide HCl (EDC, Carbosynth), 1,6-diaminohexane (Sigma ...
-
No products found
because this supplier's products are not listed.
Ibrahim Hawwari, et al.,
bioRxiv - Immunology 2023
Quote:
... injection of 2 mg/kg of polyclonal rat anti-mouse GPIbα (R300) or same amounts of a polyclonal rat IgG none-immune (C301) antibody as control (Emfret Analytics). Mice were then challenged 12 hours later with i.v ...
-
No products found
because this supplier's products are not listed.
Seokho Kim, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... Active GLP-1 (7-36) was measured using the Mouse / Rat GLP-1 Active (7-36) ELISA Kit (Eagle Biosciences, GP121-K01).
-
No products found
because this supplier's products are not listed.
Sytse J. Piersma, et al.,
bioRxiv - Immunology 2020
Quote:
... and host Actb (Forward: 5’-AGCTCATTGTAGAAGGTGTGG-3’; Reverse: 5’ - GGTGGGAATGGGTCAGAAG-3’; Probe: 5’-TTCAGGGTCAGGATACCTCTCTTGCT-3’; IDT DNA) against plasmid standard curves using TAQman universal master mix II on a StepOnePlus real time PCR system (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Eric Vallabh Minikel, et al.,
bioRxiv - Neuroscience 2019
Quote:
Rat and cynomolgus monkey CSF were purchased from BioIVT. Human brain tissue was from a non-prion disease control individual provided by the National Prion Disease Pathology Surveillance Center (Cleveland ...
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Naomi R. Shvedov, et al.,
bioRxiv - Neuroscience 2023
Quote:
... a 3 mm diameter round coverglass (3 mm circular, #1, Thomas Scientific), bonded to a stainless steel cannula (304 S/S Tubing .125” OD x .115” ID x 0.019” ...
-
No products found
because this supplier's products are not listed.
Samantha A. Scott, Jingjing Fu, Pamela V. Chang,
bioRxiv - Microbiology 2023
Quote:
... Indole-3-aldehyde (I3A) and indole-3-pyruvate (IPyA) were obtained from Biosynth. Tryptophol (IEt) ...
-
No products found
because this supplier's products are not listed.
Shouyan Deng, et al.,
bioRxiv - Immunology 2022
Quote:
... LAG-3 (LA3-H5255; Acrobiosystems), TIM-3 (TM3-H5258 ...
-
No products found
because this supplier's products are not listed.
Vanesa Fernández-Majada, et al.,
bioRxiv - Cell Biology 2021
Quote:
... CHIR99021 (3 µM, Tebu-bio) and valproic acid (1 mM ...
-
Rat Insulin Like Protein 3 (INSL3) Chemiluminescent Immunoassay (CLIA) Kit is a Competitive...
Cat# abx490511-96T,
96 tests USD $957.0
Ask
M. Inês Pascoal Ramos, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... or collagen III (human, R&D Systems; mouse, Abbexa; rat, Yo Protein). NC410 protein was diluted in assay buffer (ForteBio ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Andrew J. Lutkewitte, et al.,
bioRxiv - Physiology 2020
Quote:
... or AAV8-GFP-U6-Mogat1-shRNA (sequences 5-UUUCACCCUCAUGGAAUAUUCGUGCCU-3 and 5-CAAGACGCAAUGUAUGAUUCAAUGGGA-3 [20]; pooled (2.0 x 1011 GC total) before injection (Vector Biolabs). For hepatic Mogat1 overexpression ...
-
No products found
because this supplier's products are not listed.
Nobunao Ikewaki, et al.,
bioRxiv - Pharmacology and Toxicology 2021
Quote:
... 3’-diaminobenzidine/H2O2 solution (Nichirei Bioscience Inc., Japan). The primary antibody used was monoclonal antibody to mouse macrophages (BMA Biomedicals ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
... and dog models effluent samples (human and rat: Abcam; dog: Immunology Consultants Laboratory, Inc., Portland, OR, USA) and the assays were performed according to the protocol provided by each vendor.
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Duy Lan Huong Bui, et al.,
bioRxiv - Cell Biology 2023
Quote:
... using a 1:3 mixture of LipoD293 (SignaGen Laboratories SL100668). 48 hours later ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Joep Houkes, et al.,
bioRxiv - Synthetic Biology 2021
Quote:
... resuspension buffer supplemented with 3 μL 1000 U/mL Zymolase (Amsbio) and incubated for 30 min at 37 °C to digest the cell walls ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Lisa Duvick, et al.,
bioRxiv - Neuroscience 2023
Quote:
... 3-dimensional CT images were analyzed using Imaris 9.8 (Oxford Instruments). Kyphosis index was determined based on where the distance is calculated from a horizontal line drawn from the center of the C7 vertebrae to the center of the pelvis ...
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Jean Farup, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and Collagen 3 (Cat nb GWB-7D650E, Genway Biotec Inc, CA, USA). After incubation in primary antibodies the membranes were incubated 1 hour with HRP-conjugated secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Wei-Chun Chang, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... a cortisol ELISA kit (Salivary Cortisol Enzyme Immunoassay Kit, Salimetrics) was used according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Timur O Yarovinsky, et al.,
bioRxiv - Immunology 2019
Quote:
... We used HBsAg ELISA kit from XpressBio and the HBsAg standard from CellBioLabs to measure serum HBsAg in the chronic HBV infection model.
-
No products found
because this supplier's products are not listed.
Stavros Giaglis, et al.,
bioRxiv - Immunology 2021
Quote:
... utilizing the human TAT Complexes ELISA Kit (Assaypro) and the Imuclone D-Dimer ELISA Kit (American Diagnostica ...
-
No products found
because this supplier's products are not listed.
Natalia Salvadores, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Fluoro-Jade C staining: the FJC ready-to-dilute staining kit (Biosensis) was used ...
-
No products found
because this supplier's products are not listed.
Noelia Perez Diaz, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... bronchi and parenchyma from naïve rats was measured using Rat PPARβ/δ ELISA kit (Abbkine) according to the manufacturer’s instructions ...
-
Insulin is a pancreatic hormone that regulates glucose metabolism, cellular uptake, as well as...
Cat# 9004-10-8,
Inquire
Ask
Marco Tigano, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 10 μg/ml insulin (BOC Sciences), 2 mM L-glutamine (Gibco™) ...
-
No products found
because this supplier's products are not listed.
Farshad Guirakhoo, et al.,
bioRxiv - Immunology 2021
Quote:
... Rat IL-4 T cell ELISpot kit (U-CyTech, Cat. No.: CT081) and Rat IL-2 ELISpot Kit (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Chamitha Weeramange, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cultures were grown at 37°C to saturation in 3 mL of MOPS media (Teknova, Hollister ...
-
No products found
because this supplier's products are not listed.
Eva Perez-Martin, et al.,
bioRxiv - Zoology 2021
Quote:
A commercial kit (Life Diagnostics, Inc) specific for bovine and based on a sandwich ELISA was used for the quantitative determination of haptoglobin in buffalo serum following the instructions ...
-
No products found
because this supplier's products are not listed.
Benjamin Ng, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... using the Quickzyme Total Collagen assay kit (Quickzyme Biosciences).
-
No products found
because this supplier's products are not listed.
Mengdi Yang, et al.,
bioRxiv - Bioengineering 2022
Quote:
... RNA was extracted by RNApure Tissue & Cell Kit (CoWin Biosciences, CW0560S) as manufacturer’s instructions except for DNase I treatment ...