-
No products found
because this supplier's products are not listed.
Hao Zhang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... A Mouse Relaxin-3 ELISA Kit was purchased from Signalway Antibody LLC (MD ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Miguel A. Olivencia, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
25-hydroxyvitamin D and testosterone levels were measured in rat citrated plasma and human EDTA plasma using a General 25-Hydroxyvitamin D3 (HVD3) ELISA Kit (Reddot Biotech Inc., Kelowna, Canada) and Testosterone ELISA DE1559 (Demeditec ...
-
No products found
because this supplier's products are not listed.
Athina Kilpeläinen, et al.,
bioRxiv - Immunology 2021
Quote:
... The second ELISA was a commercially available IgM and IgG class antibody ELISA against the SARS-CoV-2 NP (ImmunoDiagnostics, Hongkong). Briefly ...
-
No products found
because this supplier's products are not listed.
Tania Ray, et al.,
bioRxiv - Cell Biology 2020
Quote:
... transfected cells were placed in Rat MSC medium (Rat MSC growth medium kit, Cell Applications, Inc.) and incubated for 14 days in incubator (37°C ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Emily E. Bonacquisti, et al.,
bioRxiv - Bioengineering 2021
Quote:
... The sEVs were then incubated with a 2:1 mass ratio of TO-3 or TO-1 (ABM Technologies) for 30 min at room temperature ...
-
No products found
because this supplier's products are not listed.
RE Akhigbe, A.F Ajayi,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
ELISA kits used for the analysis of reproductive hormones were from Monobind Inc. ...
-
No products found
because this supplier's products are not listed.
Amanda R. Dicks, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... and sclerotome (3 days; 1 µM Wnt-C59, 2 µM purmorphamine [cat. num. 04-0009; Reprocell, Beltsville, MD]) into chondroprogenitor cells (6 days ...
-
No products found
because this supplier's products are not listed.
Ziqiang Lin, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Sections were incubated in Histoclear (2×3 min; National Diagnostics, USA) and cover-slipped with mounting medium (Sigma Aldrich ...
-
No products found
because this supplier's products are not listed.
Pierluigi Di Chiaro, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Collagen IV alpha 2 (3 μg/ml, Atlas Antibodies, #HPA069337), anti-LAMA5 (5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Luca A. Andronico, et al.,
bioRxiv - Biophysics 2024
Quote:
... 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine (POPC) and 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC)) were purchased from Bangs Laboratories and Avanti Polar Lipids ...
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
William Beimers, et al.,
bioRxiv - Biochemistry 2021
Quote:
... 1-2 mg/mL Zymolyase (AMSBIO, 120493-1)] for lysis at 30°C for 15 min ...
-
No products found
because this supplier's products are not listed.
E.E. Van Haaften, et al.,
bioRxiv - Bioengineering 2020
Quote:
... the supernatants were consecutively incubated with antibody-conjugated MagPlex microspheres (1 h), biotinylated antibodies (1 h), and streptavidin-phycoerythrin (10 min, diluted in high performance ELISA (HPE) buffer (Sanquin)) ...
-
No products found
because this supplier's products are not listed.
Gregory C. Howard, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... cultures were pulsed with 1 mM 2’-azido-2’-deoxycytidine (Biosynth), or 0.1% DMSO for an unlabeled control ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kanako Saito, et al.,
bioRxiv - Neuroscience 2019
Quote:
... anti-GFP (rat, 04404-84, Nacalai Tesque, 1:500; rabbit, 598, MBL, 1:500; chick, GFP-1020, Aves Labs, 1:500). After washes ...
-
No products found
because this supplier's products are not listed.
Ding Xiong, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2 to 3×106 cells were seeded in one 35mm glass bottom culture dishes (MatTek) after transient transfection ...
-
No products found
because this supplier's products are not listed.
Daniel Pölöske, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... Ba/F3 cells were grown in the presence of 1 ng/mL murine IL-3 (mIL-3, Immunotools). Mycoplasma contamination was regularly excluded using the MycoAlert mycoplasma detection kit (Lonza Group AG ...
-
No products found
because this supplier's products are not listed.
John Heath, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... at 1:3 ratio and spread over the CometSlide (Trevigen). Slides were dried at room temperature for 2 minutes and immersed into neutral lysis buffer overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Xin Zhang, et al.,
bioRxiv - Cell Biology 2021
Quote:
... goat anti-rat IgG coupled to 1.4 nm gold 1:300 (Nanogold, Nanoprobes, Yaphank, NY, USA) in blocking solution followed the procedures as previously described [47] ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
Timur B. Kamalitdinov, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 5-days post-surgery along with 5-Ethynyl-2′-deoxyuridine (EdU, Click Chemistry Tools, 3 mg/kg) every day (n = 4-5/group) ...
-
No products found
because this supplier's products are not listed.
Kevin R. Trabbic, et al.,
bioRxiv - Immunology 2021
Quote:
β-1,3(1-6) glucan (Yeast Beta Glucan, Megazyme, Bray, Ireland; 3 mg) was suspended in 4.9 mL MilliQ H2O contaning 100 μL of 1 M NaOH ...
-
No products found
because this supplier's products are not listed.
Dasmanthie De Silva, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... The WPRE 3’-UTR sequence was amplified from the CD813A-1 (System Biosciences) vector.
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Kathrin Leppek, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... The cDNA was further diluted by 1/3 and 1/10 in ROX350/HiDi and samples loaded onto capillary electrophoresis sequencers (ABI-3730) on capillary electrophoresis (CE ...
-
No products found
because this supplier's products are not listed.
Caterina Di Sano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 1% nonessential amino acids and 2□mM L‐glutamine (all from Euroclone) was used for culturing A549 and Colo 699.The cells were maintained in an incubator at 37□°C with a humidified atmosphere with 5% CO2and were maintained as adherent monolayers ...
-
No products found
because this supplier's products are not listed.
Alexandra A.M. Fischer, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... ACC 635) and U2OS 2-6-3[67] cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM, PAN Biotech, catalog no. P04-03550) completed with 10% (v/v ...
-
No products found
because this supplier's products are not listed.
Tamar Frankovits, et al.,
bioRxiv - Developmental Biology 2024
Quote:
Animals were injected with zfp-1 dsRNA using Nanoject III (CAT 3-000-207, Drummond Scientific company). Briefly ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
Silvana Guioli, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... rat anti ERα (1:200, Fitzgerald), rabbit anti-DMRT1 (1:1500 ...
-
No products found
because this supplier's products are not listed.
Md Gulam Musawwir Khan, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... Cell survival was measured using the WST-8 (water-soluble Tetrazolium-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)- 5- (2,4-disulfophenyl)-2H-tetrazolium) assay kit (CCK-8; Dojindo Molecular Technologies, #CK04) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
G Maddaloni, YJ Chang, RA Senft, SM Dymecki,
bioRxiv - Neuroscience 2023
Quote:
... 3 steps (2 steps for Fluorogold [Fluorochrome] injections) of 5 nL each (1 min apart ...
-
No products found
because this supplier's products are not listed.
Estrela Neto, et al.,
bioRxiv - Cell Biology 2020
Quote:
... a multi-neurotrophin rapid screening ELISA kit (#BEK-2231, Tebu-bio, France) was used according to the manufacturers’ protocol ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Juan Yang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Sulfo-Cyanine 3 Azide (2-5 uM final, Lumiprobe, #D1330), and fresh Sodium Ascorbate (100 mM final ...
-
No products found
because this supplier's products are not listed.
Dario Campagner, et al.,
bioRxiv - Neuroscience 2022
Quote:
... The solution was perfused at a flow rate of 2-3 ml/min with a peristaltic pump (PPS2, MultiChannel Systems or Minipuls 3, Gilson) and temperature was kept at 32-34°C ...
-
No products found
because this supplier's products are not listed.
Gabriela F. Paredes, et al.,
bioRxiv - Microbiology 2021
Quote:
... and single worms of similar size (1-2 mm length, representing adult L. oneistus) were handpicked by forceps (Dumont 3, Fine Science Tools, Canada) under a dissecting microscope ...
-
96 well glass bottom plate. Black polystyrene frame with #1 glass(0.13-0.16mm), with lid,...
Cat# P96-1-N,
20/case, $226.00
Ask
Taemoon Chung, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 3×105 MIA PaCa-2/GemLuc cells were either plated day -1 on a black-walled 6 well plate (Cellvis, Mountain View, CA) or a clear bottom 6 well plate (Corning ...
-
No products found
because this supplier's products are not listed.
Matthew J. Vukovich, et al.,
bioRxiv - Immunology 2023
Quote:
Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Hui Huang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 1-3 million nuclei were sonicated in 130μl microtube by Covaris M220 instrument (Power ...
-
LC Laboratories' Product Number T-8040 - Temsirolimus (CCI-779, Torisel, CAS 162635-04-3), 99% -...
Cat# T-8040, SKU# T-8040-200mg,
200 mg, $535.00
Ask
Kai Otsuka, et al.,
bioRxiv - Genomics 2023
Quote:
... containing 2i (1 μM PD0325901, LC Laboratories, MA; and 3 μM CHIR99021, LC Laboratories) and LIF (1,300 U /ml ...
-
No products found
because this supplier's products are not listed.
Mustapha Dibbasey, Terry Gaymes,
bioRxiv - Cancer Biology 2021
Quote:
... Both HR plasmids (dl-1 and dl-2) and positive control plasmid were supplied with the Norgen’s Homologous Recombination kit (Norgen Biotek Corp., Thorold, ON, Canada). For each transfection ...
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Alba Fernandez-Calvo, et al.,
bioRxiv - Biophysics 2024
Quote:
The (I91)2-ClfAN2N3-(I91)2 polyprotein was fluorescently labeled by utilizing the commercial protein Labeling Kit RED-NHS 2nd Generation (Nanotemper Technologies GmbH, Munich, Germany). The dye carries a reactive NHS-ester group that reacts with primary amines in the protein to form a covalent bond ...
-
No products found
because this supplier's products are not listed.
Dony Maiguel, et al.,
bioRxiv - Biochemistry 2022
Quote:
... [1-14C]oleic acid (C18:1) and [1-14C]linoleic acid (C18:2) were obtained from American Radiolabeled Chemicals (St. Louis, MO). [1-14C]stearic acid was obtained from Amersham Biosciences ...