Labshake search
Citations for Avidity :
1 - 50 of 82 citations for Rat Indoleamine 2 3 Dioxygenase 1 IDO1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Protein antigens used for LIBRA-seq and serum ELISA contained a C-terminal Avi-tag and were site specifically biotinylated using BirA biotin-protein ligase raction kit (Avidity) according to manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before18 ...
-
bioRxiv - Molecular Biology 2021Quote: ... in-frame with the 3’Avitag (Avidity) sequence GGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAA ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 NTD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (Robbiani et al. ...
-
bioRxiv - Immunology 2021Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before 1 ...
-
bioRxiv - Immunology 2021Quote: ... The captured SARS-CoV-2 protein was then biotinylated using the BIRA500 kit (∼2.5 μg per 10 nmol AVI substrate) (Avidity) and cleaved from the Fc purification tag concurrently with 200 μg of HRV3C prepared as described [42] ...
-
bioRxiv - Immunology 2020Quote: Purified and Avi-tagged SARS-CoV-2 RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 WT and Delta RBD was biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before(Robbiani et al. ...
-
bioRxiv - Immunology 2022Quote: ... Avi-tagged SARS-CoV-2 RBD and SD1-RBD (both corresponding to SARS-CoV-2 ancestral virus) were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity). Ovalbumin (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... pFN18a (Ig32)2-(R3IVVI)-(Ig32)2 was subcloned into a modified pFN18a vector engineered with the AviTagTM (Avidity) (sequence GLNDIFEAQKIEWHE) ...
-
bioRxiv - Immunology 2022Quote: Purified and Avi-tagged SARS-CoV-2 Wuhan-Hu-1 RBD and NTD were biotinylated using the Biotin-Protein Ligase-BIRA kit according to manufacturer’s instructions (Avidity) as described before (11) ...
-
bioRxiv - Immunology 2020Quote: ... we biotinylated SARS-CoV-2 RBD using a terminal AviTag and BirA biotin ligase (Avidity) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... The avi-tagged SARS-CoV-2 RBD antigen was first labeled with biotin (Avidity, BirA500) was subsequently coupled to streptavidin-PE and streptavidin-APC (BD Biosciences ...
-
bioRxiv - Bioengineering 2021Quote: ... BirA-500 kit was purchased from Avidity. Streptavidin (SA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then biotinylated with a commercial BirA kit (Avidity). Proteins were then purified from the BirA enzyme by affinity purification using a 1 mL HisTrap HP affinity column (Cytiva) ...
-
bioRxiv - Immunology 2021Quote: ... the probes were generated by the biotinylation of Avi-tagged SARS-CoV-2 antigens using biotin ligase BirA according to the manufacturer’s instructions (Avidity). Biotin excess was removed by SEC on either a Superdex 200 10/300 column (GE Healthcare ...
-
Mechanical forces impair antigen discrimination by reducing differences in T cell receptor off-ratesbioRxiv - Immunology 2022Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2020Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Immunology 2021Quote: ... biotinylated (BirA biotin-protein ligase bulk reaction kit [Avidity, USA]) and purified by size exclusion chromatography (Superdex 75 column [GE Healthcare] ...
-
bioRxiv - Cancer Biology 2022Quote: ... MHC-peptide complexes were biotinylated using a BirA reaction kit (Avidity) per manufacturer’s instructions in the presence of excess peptide and β2M at 25°C for 4 hours ...
-
bioRxiv - Immunology 2022Quote: ... Biotinylation was performed using a BirA biotin-protein ligation kit (Avidity) on proteins produced with a C-terminal avidin tag sequence ...
-
bioRxiv - Microbiology 2020Quote: ... a BirA biotin-protein ligase kit (Avidity, LLC; Aurora, CO, USA) was used to biotinylate protein samples ...
-
bioRxiv - Evolutionary Biology 2022Quote: Biotinylation of the HAs was performed using the BirA500 kit (Avidity) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... spike protein probes were added one-by-one to FACS wash buffer (1x PBS, 2% fetal bovine serum) containing 5μM free d-biotin (Avidity, Cat. Bir500A). Both streptavidin-fluor conjugates were used to stain DMSO control samples to further verify the absence of significant frequencies of non-specific streptavidin-binding B cells.
-
bioRxiv - Immunology 2022Quote: ... purified fractions were biotinylated using a BirA protein ligase kit (Avidity LLC). The biotinylated proteins were further purified by gel filtration (S200 ...
-
bioRxiv - Immunology 2020Quote: ... Biotinylation was performed using biotinprotein ligase standard reaction kit (Avidity, Cat# Bir500A) following the manufacturers standard protocol and dialyzed over-night against PBS ...
-
bioRxiv - Immunology 2023Quote: ... competing antibody was diluted to a final concentration of 5 µg/mL in blocking buffer and added to 2 µg/mL GP that was biotinylated through a fused Avi-tag (Avidity, Aurora, Colorado) and incubated for one hour at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... HLA-I/peptide tetramer staining solution was prepared by mixing all tetramers into a solution of 1:1 FACS buffer and Brilliant Buffer containing 0.2% milk and 5μM free D-biotin (Avidity LLC) immediately prior to staining ...
-
bioRxiv - Bioengineering 2021Quote: The purified protein was biotinylated by BirA using a BirA-500 kit (Avidity). Typically ...
-
bioRxiv - Microbiology 2021Quote: ... Purified SARS2 D614G spike protein was biotinylated using BirA500 biotinylation kit from Avidity. To 50 ug of spike protein ...
-
bioRxiv - Immunology 2021Quote: ... Avi-Tagged FcRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Biotinylation was performed using the BirA ligase reaction kit (Avidity, cat. no. BirA500).
-
bioRxiv - Immunology 2022Quote: ... Biotinylation of monomer was carried out using BirA biotin-protein ligase kit (Avidity) according to manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... Overnight biotinylation reactions were performed using the BirA Biotin-Protein Ligase Kit (Avidity) at 4℃ in 1x BiomixA ...
-
bioRxiv - Biochemistry 2024Quote: ... The HKU1 RBDs were biotinylated using the BirA biotin ligase reaction kit (Avidity) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Tetramers with an AviTag were biotinylated with the BirA biotin-ligase kit (Avidity) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... the purified RBDs were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity). The biotinylated proteins were re-purified and concentrated as described above ...
-
bioRxiv - Microbiology 2020Quote: ... The RBD with a BirA tag was biotinylated using a biotinylation kit (Avidity, LLC) and was immobilized through the Biotin CAPture Reagent ...
-
bioRxiv - Molecular Biology 2022Quote: ... the proteins were biotinylated using the BirA biotin-protein ligase reaction kit (Avidity, #BirA500). Biotinylation of the NiV protein probes was confirmed by biolayer interferometry by testing the ability of the biotinylated protein to bind to streptavidin sensors ...
-
bioRxiv - Immunology 2021Quote: ... each FcγR was biotinylated using a BirA biotin-protein ligase bulk reaction kit (Avidity) according to the protocol of the manufacturer ...
-
bioRxiv - Immunology 2023Quote: BSP-tagged proteins were biotinylated using the BirA biotin-ligase bulk reaction kit (Avidity), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... biotinylation with BirA biotin-protein ligase standard reaction kit (Avidity, 318 LLC-Aurora, Colorado), and purification using size-exclusion column (Waters ...
-
bioRxiv - Immunology 2022Quote: ... VH F6 was biotinylated with BirA biotin-protein ligase standard reaction kit (BirA500, Avidity, USA). Streptavidin biosensors (ForteBio ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were biotinylated overnight at 4°C using a BirA biotinprotein ligase reaction kit (Avidity) and re-purified using the same HisTrap HP affinity method described above before being flash frozen.
-
bioRxiv - Immunology 2024Quote: ... Avi-tagged Rhesus macaque FcγRs (Duke Human Vaccine Institute) were biotinylated using BirA500 kit (Avidity) per manufacturer’s instructions and tagged with streptavidin-PE ...
-
bioRxiv - Immunology 2024Quote: ... The purified spike protein was biotinylated using the BirA biotin-protein ligase reaction kit (Avidity) following the manufacturer’s recommendation ...
-
bioRxiv - Biophysics 2021Quote: ... Ecads bound to the Ni-NTA beads were biotinylated with BirA enzyme (BirA 500 kit; Avidity) for 1hr at 300C ...
-
bioRxiv - Biophysics 2022Quote: ... Ecads bound to the Ni-NTA beads were biotinylated with BirA enzyme (BirA 500 kit; Avidity) for 1 h at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... TGEV and CCoV-HuPn-2018 were biotinylated using BirA biotin-protein ligase standard reaction kit (Avidity) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Site-specific biotinylation of the AviTag was performed using BirA Biotin-Protein Ligase Reaction kit (Avidity). Next ...