-
No products found
because this supplier's products are not listed.
Uli Schmitz, et al.,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
... The HBeAg and HBsAg ELISAs were performed using the HBeAg ELISA kit (International Immuno-Diagnostics, Foster City, CA) and HBsAg ETI-MAK-2 plus kit (DiaSorin ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Eun Jeong Lee, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Plasma ACTH concentrations were measured using the ACTH ELISA kit (MD Biosciences), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Tomasz Zieliński, et al.,
bioRxiv - Biophysics 2022
Quote:
... CytoGlow™ Cofilin (Phospho-Ser3) Colorimetric Cell-Based ELISA Kit was applied (Assay Biotechnology) to monitor target proteins concentration ...
-
No products found
because this supplier's products are not listed.
Kathleen M.E. Gallagher, et al.,
bioRxiv - Immunology 2021
Quote:
A qualitative ELISA for Human Anti-IgG/A/M SARS-CoV-2 ELISA (The Binding Site) was performed using donor serum per manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Ke-Ming Xie, et al.,
bioRxiv - Microbiology 2024
Quote:
... (3) Air Samples: BioSamplers KIT (225-9595, SKC, Eighty Four, PA) were installed at approximately 1.5 meters above floor at the ventilation points in the slaughter area ...
-
Endothelin 3 is a ligand of the endothelin (ET) receptors and a potent vasoconstrictor....
Cat# B2693-359677,
1 mg/unit USD $199
Ask
Alexandra Gros, et al.,
bioRxiv - Neuroscience 2023
Quote:
... These rats also received one intraperitoneal injection of 5-Bromo-2’-deoxyuridine (BrdU, 200 mg/kg in 0.9% NaCl, BOC Sciences 59-14-3) 24h before sacrifice to study adult newborn cell proliferation after several days of simulated microgravity exposure and to reduce the number of animals used for this study.
-
No products found
because this supplier's products are not listed.
Renata Varnaitė, et al.,
bioRxiv - Immunology 2020
Quote:
... SARS-CoV-2 specific IgM antibodies were detected using EDI Novel Coronavirus COVID-19 IgM ELISA kit (Epitope Diagnostics), according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Kyung-Jin Jang, et al.,
bioRxiv - Pharmacology and Toxicology 2019
Quote:
Alpha Glutathione S-Transferase (α-GST): levels were quantified in human model effluent samples from the upper channel using an ELISA kit (DiaPharma). The assay was run following the vendor protocol using a standard curve ranging from 0-64 µg/L ...
-
No products found
because this supplier's products are not listed.
Hsiu-Chuan Lin, et al.,
bioRxiv - Bioengineering 2023
Quote:
... co-cultured with rat cortical astrocytes (Genlantis) on PLO/LMN-coated 8-well or 96-well polymer coverslips (µ-Slide ibiTreat ...
-
No products found
because this supplier's products are not listed.
Hower Lee, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Rat brain slices were purchased fresh-frozen (Zyagen), kept at −80 until use and processed the same way as chicken and mouse sections.
-
No products found
because this supplier's products are not listed.
Katharina Braunger, et al.,
bioRxiv - Immunology 2021
Quote:
... rat and guinea pig serum were from Complement Technology.
-
No products found
because this supplier's products are not listed.
Wren E. Michaels, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Cell lysates were prepared and diluted to 3 mg/ml using the sample preparation kit (Protein Simple) for an automated capillary western blot system ...
-
No products found
because this supplier's products are not listed.
Michael P. Doyle, et al.,
bioRxiv - Immunology 2022
Quote:
... Cell supernatants were screened by ELISA using recombinant YFV E protein (Meridian Life Sciences). Wells with positive reactivity were fused to a human-mouse myeloma cell line (HMMA 2.5 ...
-
No products found
because this supplier's products are not listed.
Steffi Daniel, John D. Hulleman,
bioRxiv - Neuroscience 2022
Quote:
... fibulin-3 blocking peptide (5:1 to anti-fibulin-3 antibody, Prosci # 5213P). The next day ...
-
No products found
because this supplier's products are not listed.
Nicholas G. Lamson, et al.,
bioRxiv - Bioengineering 2022
Quote:
... 1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) was purchased from Chem-Impex. Falcon cell strainer tubes were purchased from Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Qi Qu, et al.,
bioRxiv - Physiology 2023
Quote:
... TAG(16:0)3-d5 and TAG(18:0)3-d5 (CDN isotopes), while DAGs d5-DAG17:0/17:0 and d5-DAG18:1/18:1 (Avanti Polar Lipids) ...
-
No products found
because this supplier's products are not listed.
Yuko Ishida, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... rat anti-mouse F4/80 mAb (clone, BM8; BMA Biomedicals, Switzerland), rabbit anti-human CD3 pAbs ...
-
No products found
because this supplier's products are not listed.
Shogo Soma, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rats received 100 nL of Fluoro-Gold (2.5% in H2O, Fluorochrome) and 1,200 nL of mRFP expressing G-deleted rabies viral vector (rHEP5.0-ΔG-mRFP ...
-
No products found
because this supplier's products are not listed.
Daniel A. Kramer, et al.,
bioRxiv - Biochemistry 2023
Quote:
... All measurements were performed on a Horiba Scientific FluoroMax spectrofluorometer in 3 mm quartz cuvettes (Starna Cells, Inc. Cat # 3-3.45-Q-3). Normalized peak fluorescent values were calculated by dividing the fluorescence value of the peak by the concentration of that sample.
-
No products found
because this supplier's products are not listed.
Sabrina X. Van Ravenstein, et al.,
bioRxiv - Biochemistry 2022
Quote:
... TOP2β (Topogen, Cat# tg2010-3).
-
No products found
because this supplier's products are not listed.
Megan L. Schaller, et al.,
bioRxiv - Physiology 2024
Quote:
... Samples were incubated in 3% acetic acid for 3 minutes followed by Alcian Blue (Newcomer Supply, 1003A) for 30 minutes at room temperature ...
-
No products found
because this supplier's products are not listed.
Aly Elezaby, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Serum lactate dehydrogenase level was measured at 3 days after MI by commercially available kit following manufacturer’s instructions (Eton Bioscience, San Diego, CA, USA). Fractional shortening was determined under basal conditions and after isoproterenol stimulation (10μg/kg ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Romina Ulloa, et al.,
bioRxiv - Cell Biology 2021
Quote:
... ∼2 × 107 3-μm latex NH2-beads (Polyscience) were activated with 8% glutaraldehyde for 4 h at room temperature ...
-
No products found
because this supplier's products are not listed.
Greg Tram, et al.,
bioRxiv - Microbiology 2019
Quote:
... 3 µm particle size (Tosoh Biosciences, Tokyo, Japan). Samples were resuspended in buffer B (90% MeCN / 0.1% TFA ...
-
No products found
because this supplier's products are not listed.
Haichen Wang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... 1.0 U in 0.40 mL normal saline for rats) via Hamilton syringe (Hamilton Company; Reno, NV) advanced into the cortex (depth = 3 mm in mouse ...
-
No products found
because this supplier's products are not listed.
Zijun Sun, Thomas C. Südhof,
bioRxiv - Neuroscience 2020
Quote:
... fetal bovine serum (ATLANTA Biological; final concentration = 2-3%) were added to the culture medium ...
-
No products found
because this supplier's products are not listed.
Sarah A Fahlberg, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3 μg/mL anti-myc IgY (Aves Labs) conjugated with Alexa488 using NHS chemistry ...
-
No products found
because this supplier's products are not listed.
Jiajie Xu, Juan J.L. Guzman, Largus T. Angenent,
bioRxiv - Bioengineering 2020
Quote:
... The increased solution volume in chamber #3 was pumped (Cole-Parmer L/S Digital Economy Drive ...
-
No products found
because this supplier's products are not listed.
Jiahn Choi, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 3′-diaminobenzidine (DAB) for visualization of the antigen-antibody complex (Scytek).
-
No products found
because this supplier's products are not listed.
Matthias Schmidt, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and 3-hydroxy-2,4-dimethylhexanoic acid were synthesized by Enamine (Ukraine).
-
No products found
because this supplier's products are not listed.
Kosuke Fukui, et al.,
bioRxiv - Plant Biology 2021
Quote:
... and desalted by Spectra/Por® Dialysis Membrane 3 (Spectrum Labs, USA) with Buffer IV (10 mM NaCl ...
-
No products found
because this supplier's products are not listed.
Takuma Uo, et al.,
bioRxiv - Cancer Biology 2024
Quote:
Uptake of 3H-3-O-methylglucose (American Radiolabeled Chemicals, St. Louis, MO) and 3H-2-deoxyglucose (Perkin Elmer ...
-
No products found
because this supplier's products are not listed.
Dalia Rosano, et al.,
bioRxiv - Cancer Biology 2021
Quote:
CloneTracker XP 10M Barcode-3’ Library with RFP-Puro (BCXP10M3RP-P) was purchased from Cellecta. Production of lentiviral particles and MCF7 transduction was performed following CloneTracker™ XP Lentiviral Expressed Barcode Libraries online manual (https://manuals.cellecta.com/clonetracker-xp-lentiviral-barcode-libraries/) ...
-
No products found
because this supplier's products are not listed.
Chamitha Weeramange, et al.,
bioRxiv - Microbiology 2023
Quote:
... Cultures were grown at 37°C to saturation in 3 mL of MOPS media (Teknova, Hollister ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Nima Taefehshokr, et al.,
bioRxiv - Immunology 2023
Quote:
... and DNA isolation kits were from FroggaBio (Concord, Canada), and all laboratory chemicals were from Bioshop Canada (Burlington ...
-
No products found
because this supplier's products are not listed.
Marlou L. Dirks, et al.,
bioRxiv - Physiology 2023
Quote:
... Arterialized serum samples were used to determine insulin concentrations (Human insulin ELISA kit, DX-EIA-2935; Oxford Biosystems Ltd, Milton Park, UK). Serum NEFA concentrations were measured spectrophotometrically in arterialized venous and deep-venous serum samples (FA115 kit ...
-
No products found
because this supplier's products are not listed.
Jayanth S. Shankara Narayanan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... anti-Rat HRP Polymer (Cell IDX, 2AH-100) or anti-Rabbit HRP Polymer (Cell IDX ...
-
No products found
because this supplier's products are not listed.
Ilana B. Kotliar, et al.,
bioRxiv - Biochemistry 2022
Quote:
... 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (c1100) was from ProteoChem. N-hydroxysuccinimide was from Pierce (CAS:6066-82-6).
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Danielle M Paul, et al.,
bioRxiv - Cell Biology 2019
Quote:
... Kinesore (3,5-dibromo-N′-[2,5-dimethyl-1-(3-nitrophenyl)-1H-pyrrol-3-yl]methylene}-4-hydroxybenzohydrazide) was obtained from Chembridge Corporation (Cat ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
Magnetofection
diificult to transfect cells
Cat# KM30350,
SilenceMag 200µL + CombiMag 100µL, USD $186.00/KIT
Ask
Viktória Szentgyörgyi, et al.,
bioRxiv - Immunology 2024
Quote:
... cells were transfected with 6 μg of the plasmids (3-3 μg for both targeted exon of LRBA) with Helix IN transfection reagent (OZ Biosciences). For control cells control vectors without gRNA insert were transfected ...
-
No products found
because this supplier's products are not listed.
Teodors Pantelejevs, Marko Hyvönen,
bioRxiv - Biochemistry 2022
Quote:
... lysate was loaded on a 3 mL Ni-NTA agarose matrix (Cube Biotech), after which column matrix was washed with 10 CV Nickel Buffer A ...