-
No products found
because this supplier's products are not listed.
Lun Zhang, et al.,
bioRxiv - Neuroscience 2023
Quote:
... in samples from brain lysates of mice and cell culture supernatants were determined using corresponding ELISA kits (pro-inflammatory cytokine ELISA kits were obtained from Neobioscience technology, anti-inflammatory cytokine ELISA kits were obtained from Bioss) according to the manufacturer’s protocols ...
-
No products found
because this supplier's products are not listed.
Khushali Patel, et al.,
bioRxiv - Developmental Biology 2023
Quote:
... ELISAs were performed using a β-hCG ELISA kit (EIA-1911; DRG International Springfield NJ) and IL-1β ELISA kit (DY401-05 ...
-
No products found
because this supplier's products are not listed.
F. Locatelli, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Whole-cell patch-clamp was performed from the soma of Golgi cells Patch pipettes were pulled from borosilicate glass capillaries (Sutter Instruments) and filled with an intracellular solution containing (in mM) ...
-
No products found
because this supplier's products are not listed.
Xing-Hua Liao, et al.,
bioRxiv - Cell Biology 2020
Quote:
Cardiac myocytes were isolated from day 1-3 Sprague-Dawley rat pups as described previously.(11–13) COS7 cells were bought from American Type Culture Collection (ATCC) and cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
No products found
because this supplier's products are not listed.
Xiaojuan Yang, et al.,
bioRxiv - Neuroscience 2020
Quote:
... rat monoclonal mAb7a (rb7a, Synaptic Systems, #147208), and rabbit polyclonal (rbGPHN ...
-
No products found
because this supplier's products are not listed.
Qian Qin, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... MAS-Seq for 10x Single Cell 3’ kit (PacBio, cat. no. 102-659-600), and individually created oligos ...
-
No products found
because this supplier's products are not listed.
Susmita Khamrui, et al.,
bioRxiv - Biochemistry 2024
Quote:
... 3-hydroxy-3-methylglutaric acid (HMG) was obtained from TCI or Cayman Chemicals.
-
No products found
because this supplier's products are not listed.
Matthew G. Zimmerman, et al.,
bioRxiv - Microbiology 2019
Quote:
... 100ng of RIG-I agonist derived from the 3’-UTR of hepatitis C virus (55) was transfected per 1e6 cells using TransIT-mRNA transfection kit (Mirus). For stimulation of MDA5 signaling ...
-
No products found
because this supplier's products are not listed.
Raphaëlle Luisier, et al.,
bioRxiv - Neuroscience 2022
Quote:
Probe sets targeting the 3’UTR of rat Atf3 (Stellaris probes, Biosearch technologies) were designed using the Stellaris probe-set designer tool to specifically detect the 3’UTR of the transcript and 3’end labelled with CalFluor590 ...
-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Walter R Mancia Leon, et al.,
bioRxiv - Neuroscience 2023
Quote:
... rat anti-tdTomato (Kerafast). For staining with the Pcdhγc5 antibody ...
-
No products found
because this supplier's products are not listed.
Yanbing Chen, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Golgi-stained neurons and dendritic segments from ACC and vCA1 were examined and imaged under light microscopy (AHBT3; Olympus, Tokyo, Japan). The density of neuronal dendritic length and spines was statistically analyzed using Image J (Fuji ...
-
No products found
because this supplier's products are not listed.
Made Harumi Padmaswari, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Analysis of hF9 protein was performed using the Human Coagulation Factor IX Total Antigen ELISA Kit (Innovative Research) following the supplier’s protocol ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Glory Nasseri, et al.,
bioRxiv - Neuroscience 2021
Quote:
... The shRNA target sequence that gave maximum knockdown efficiency of rat PRG-1 was 5′-GCAAGAACGAGAGTCGCAAGA-3′ and was obtained from GeneCopoeia (Rockville, MD, #RSH090356). Human PRG-1 obtained from DNASU Plasmid Repository (The Biodesign Institute/Arizona State University ...
-
No products found
because this supplier's products are not listed.
Eike-Christian Wamhoff, et al.,
bioRxiv - Pharmacology and Toxicology 2023
Quote:
... Sera were analyzed by ELISA for the presence of anti-dsDNA IgG and IgM using commercially available kits (Chondrex Inc. ...
-
No products found
because this supplier's products are not listed.
Zhijie Chen, et al.,
bioRxiv - Biophysics 2019
Quote:
... transcription was chased by adding 40 µM NTPs mix together with 50 µM of each type of 3’-deoxynucleotide RNA chain terminators (3’dATP, 3’dCTP, 3’dGTP, 3’dUTP, TriLink Biotechnologies). The reactions were allowed to proceed at room temperature for 10 min before terminated by adding the 2× urea stop buffer ...
-
No products found
because this supplier's products are not listed.
Timm O. Koller, et al.,
bioRxiv - Biochemistry 2022
Quote:
Grids (Quantifoil R3/3 Cu300 with 3 nm holey carbon) were glow discharged and 4 µL of sample (8 OD260/mL ...
-
No products found
because this supplier's products are not listed.
Aathira Gopinath, et al.,
bioRxiv - Biophysics 2023
Quote:
... 1-oxyl2,2,5,5-tetramethyl-3-pyrroline-3-methyl methanethiosulfonate (MTSL, Toronto Research Chemicals) and kept stirring at room temperature for 30 minutes ...
-
No products found
because this supplier's products are not listed.
Samantha J. Ziegler, et al.,
bioRxiv - Biophysics 2024
Quote:
... Grids were blotted for 3 seconds using a CP3 Cryoplunge 3 (Gatan Ametek Inc.) before being plunged into liquid ethane held at –168 °C ...
-
Obestatin(rat), encoded by the Ghrelin gene, is a cpeptide, comprised of 23 amino acids....
Cat# P1124, SKU# P1124-5mg,
5mg, $190.00
Ask
Vivek K. Bajpai, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 3 μM CHIR99021(Selleck Chemicals) was added ...
-
No products found
because this supplier's products are not listed.
Brendan P. Lehnert, et al.,
bioRxiv - Neuroscience 2021
Quote:
... 3 mm WD objective (Nikon) with scan mirror excursions that produced a 510 x 510 μm2 field of view ...
-
No products found
because this supplier's products are not listed.
Ramile Dilshat, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Primers were designed using NCBI primer blast (Table 3) and qRT-PCR was performed using SensiFAST™ SYBR Lo-ROX Kit (#BIO-94020, Bioline) on the BIO-RAD CFX38 Real time PCR machine ...
-
No products found
because this supplier's products are not listed.
Rachel P. Tillage, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and processed according to the manufacturer’s instructions (Galanin Rat and Mouse ELISA kit, S1208, Peninsula Laboratories, San Carlos, CA). Wells were read at 450 nm ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Fadil M. Hannan, et al.,
bioRxiv - Genetics 2020
Quote:
... and FGF23 using a two-site ELISA kit (Kainos Laboratories), as described (19) ...
-
No products found
because this supplier's products are not listed.
Tania Ray, et al.,
bioRxiv - Cell Biology 2020
Quote:
... transfected cells were placed in Rat MSC medium (Rat MSC growth medium kit, Cell Applications, Inc.) and incubated for 14 days in incubator (37°C ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Xiaoyun Ji, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... caspase-3 activity in cell lysates was measured using a Caspase-3 Fluorescence Assay Kit (Biomol Research Laboratories ...
-
No products found
because this supplier's products are not listed.
Erin M. Harberts, et al.,
bioRxiv - Immunology 2021
Quote:
... to Immulon ELISA plates (ImmunoChemistry Technologies) that were pre-coated with anti-IL-1β capture antibody (eBioscience) ...
-
No products found
because this supplier's products are not listed.
Jack Polmear, et al.,
bioRxiv - Immunology 2023
Quote:
96-well high-binding ELISA plates (Sarstedt) were coated overnight at 4°C with either goat anti-mouse IgA ...
-
No products found
because this supplier's products are not listed.
Sarah M. Mohr, et al.,
bioRxiv - Physiology 2024
Quote:
... T3 concentration was measured by ELISA (Leinco Technologies, T181). Dried product was resolubilized in the zero-standard and the kit run according to the manufacturer’s instructions.
-
No products found
because this supplier's products are not listed.
Petr Dvořák, et al.,
bioRxiv - Plant Biology 2020
Quote:
... Samples were incubated with rat anti-FSD1 (Agrisera) primary antibody diluted at 1:250 ...
-
No products found
because this supplier's products are not listed.
Claudia Prahst, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... 3% BSA (Nzytech), 0.5% Triton X100 (Sigma) ...
-
No products found
because this supplier's products are not listed.
Saskia D. van Asten, et al.,
bioRxiv - Immunology 2020
Quote:
... and incubated with culture supernatants (diluted in high-performance ELISA buffer, Sanquin Reagents). Plates were again washed five times and incubated for one hour with horseradish peroxidase-conjugated mouse-anti-human-IgG (1 µg/ ml ...
-
No products found
because this supplier's products are not listed.
Ling Bai, et al.,
bioRxiv - Physiology 2021
Quote:
... Exendin-3 (ApexBio, B6943) 10 ug/mouse in saline.
-
No products found
because this supplier's products are not listed.
Donatas Repecka, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... and MultiQuant 3 (Sciex) was used for analysis and quantitation of results ...
-
No products found
because this supplier's products are not listed.
Shinya Komata, et al.,
bioRxiv - Genetics 2022
Quote:
... by QuantStudio 3 (ABI). The detailed method was followed by Iijima et al ...
-
No products found
because this supplier's products are not listed.
Jennifer Hua, et al.,
bioRxiv - Neuroscience 2022
Quote:
... rat anti-P2X4 (kind gift of F. Nolte (Universitätsklinikum Hamburg-Eppendorf)) ...
-
No products found
because this supplier's products are not listed.
Kehui Xiang, David P. Bartel,
bioRxiv - Molecular Biology 2021
Quote:
... indole-3-acetic acid (IAA, GoldBio) was dissolved in ethanol and added to cells at a concentration of 0.5 mM ...
-
No products found
because this supplier's products are not listed.
Félix Buron, et al.,
bioRxiv - Neuroscience 2023
Quote:
... etched tungsten microelectrodes (3-5MΩ, FHC) that were inserted into the brain using 26-gauge guide tubes that were passed through the recording grid and small predrilled burr holes in the skull ...
-
No products found
because this supplier's products are not listed.
Hui Zhang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... [3-13C]lactate (2mM; Cambridge Isotope Laboratory), [U-13C6]leucine (Cambridge Isotope Laboratory) ...
-
No products found
because this supplier's products are not listed.
Shuhei Murase, et al.,
bioRxiv - Bioengineering 2022
Quote:
Twelve-week-old male WKY rats were scanned in a 7.0-Tesla MRI system (Biospec 70/30-USR ...
-
No products found
because this supplier's products are not listed.
Abhishek Jamwal, et al.,
bioRxiv - Microbiology 2022
Quote:
... ft tangential filter flow unit (3 kDa, PALL). The buffer-exchanged supernatant was loaded onto a CaptureSelect™ C-tagXL pre-packed column (Thermofisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... Nanoject III (Drummond Scientific, Item# 3-000-207) was used for AuCx ...
-
No products found
because this supplier's products are not listed.
Haser Hasan Sutcu, et al.,
bioRxiv - Cell Biology 2023
Quote:
... 3 CCD camera (Carl Zeiss Microscopy GmbH, Germany) using the CRionScan software ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... Affinity Analysis 3 Software (Nanotemper) using a Kd fit model and constraining the target concentration.
-
No products found
because this supplier's products are not listed.
Bikul Das, et al.,
bioRxiv - Immunology 2020
Quote:
... ELISA plates were thoroughly washed 2 times each using 1× PBS+0.05% Tween 20 (AMRESCO, USA) and 1× PBS ...
-
No products found
because this supplier's products are not listed.
Adam R. Denton, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Brains were sliced on a standard rat brain matrix (Ted Pella, Inc., Redding, CA) at a thickness of 500 μm.