-
No products found
because this supplier's products are not listed.
Katrin Fischer, et al.,
bioRxiv - Immunology 2023
Quote:
... Valproic acid (VPA, 2-propyl-pentanoic acid, Sigma) was added 4 h post transfection to a final concentration of 3.5 mM ...
-
No products found
because this supplier's products are not listed.
Silvana Valtcheva, et al.,
bioRxiv - Neuroscience 2023
Quote:
... DL-2- amino-5-phosphono-pentanoic acid (AP5; 50 µM; Tocris, Item# 0105), 4-Aminopyridine (4- AP ...
-
No products found
because this supplier's products are not listed.
Sem H. Jacobs, et al.,
bioRxiv - Microbiology 2020
Quote:
BODIPY™ FL pentanoic acid (BODIPY-FL5, Invitrogen) was diluted in DMSO to a 3 mM stock solution ...
-
No products found
because this supplier's products are not listed.
Natsuko Ueda, et al.,
bioRxiv - Immunology 2022
Quote:
... 5 ng/ml IL-4 (R&D Systems) and 12 ng/ml IL-10 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Aniqa Tasnim, et al.,
bioRxiv - Neuroscience 2023
Quote:
... recovery aCSF included (R,S)-3-(2-Carboxypiperazin-4-yl)propyl-1-phosphonic acid (CPP, 5 μM; Abcam, ab120160) and 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline (NBQX ...
-
No products found
because this supplier's products are not listed.
Jelena Gabrilo, et al.,
bioRxiv - Immunology 2024
Quote:
... 5% FBS and 2 mM ethylenediaminetetraacetic acid (EDTA, VWR), mashed and filtered through a 70 μm cell strainer ...
-
No products found
because this supplier's products are not listed.
K.-A. Saal, et al.,
bioRxiv - Bioengineering 2022
Quote:
... in Cytoskeleton Buffer (CB, 10 mM 4-Morpholineethanesulfonic acid,2-(N-Morpholino)ethanesulfonic acid (MES #M3671, Merck), 138 mM KCl (#6781 ...
-
No products found
because this supplier's products are not listed.
Hiroyuki Mori, et al.,
bioRxiv - Physiology 2020
Quote:
... 5-(tetradecyloxy)-2-furoic acid (TOFA) (Cayman Chemical)
-
No products found
because this supplier's products are not listed.
Adam T Fishburn, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... 4°C for 5 minutes (Eppendorf centrifuge 5810 R, Rotor S-4-104). Cell pellets were washed with 5 mL D-PBS and centrifugation was repeated ...
-
No products found
because this supplier's products are not listed.
Anastasia Selyutina, et al.,
bioRxiv - Microbiology 2020
Quote:
... supplemented with 5 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (Corning, Corning, NY, USA), 50 μg/ml penicillin/streptomycin (Corning) ...
-
No products found
because this supplier's products are not listed.
Nitin Wadhwani, et al.,
bioRxiv - Cancer Biology 2022
Quote:
SJ-GBM2 and SF8628 cells were used to determine if reducing WDR82 through inducible knockdown affected cell viability 1×104 cells/100μl were plated in 96-well plates with complete cell culture medium with or without Dox (2μg/ml), and subjected to 3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, Promega) assay.
-
No products found
because this supplier's products are not listed.
Mario Mietzsch, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... 3.5 μL was applied to a glow-discharged Quantifoil copper grid with 2 nm continuous carbon support over holes (Quantifoil R 2/4 400 mesh), blotted ...
-
No products found
because this supplier's products are not listed.
Christl Gaubitz, et al.,
bioRxiv - Biochemistry 2020
Quote:
Quantifoil R 2/2 (first dataset) and quantifoil R 0.6/1 (second dataset, Electron Microscopy Sciences) grids were washed with ethyl acetate and glow discharged using a Pelco easiGlow (Pelco ...
-
No products found
because this supplier's products are not listed.
João Leandro, et al.,
bioRxiv - Biochemistry 2020
Quote:
... 4-oxo-5-hexenoic acid was obtained from Santa Cruz Biotechnology and succinylphosphonic acid was from MedChem Express ...
-
No products found
because this supplier's products are not listed.
Angela Armento, et al.,
bioRxiv - Cell Biology 2024
Quote:
... bFGF 5 ng/ml (day 2-4, AF-100-18B, Peprotech), activinA 100 ng/ml (day 4-14 ...
-
No products found
because this supplier's products are not listed.
David J. Thaller, et al.,
bioRxiv - Cell Biology 2020
Quote:
... supplemented with 2% raffinose (R; BD), 2% D-galactose (G ...
-
No products found
because this supplier's products are not listed.
Jessica Tang, et al.,
bioRxiv - Genomics 2020
Quote:
... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
No products found
because this supplier's products are not listed.
Florence E. McLean, et al.,
bioRxiv - Microbiology 2024
Quote:
... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) 25 mM (Lonza, 17-737F), gentamicin 25 μg/ml (Lonza ...
-
No products found
because this supplier's products are not listed.
Ashwin Narayanan, et al.,
bioRxiv - Cancer Biology 2024
Quote:
... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
No products found
because this supplier's products are not listed.
Jun Liu, et al.,
bioRxiv - Immunology 2021
Quote:
... and stained with fluorochrome-labeled anti-mouse IFN-γ/TNF-α/IL-2/IL-4/IL-5 mAbs (Biolegend). LSRFortessa was used to acquire the flow cytometry data ...
-
No products found
because this supplier's products are not listed.
GaYoung Park, et al.,
bioRxiv - Bioengineering 2024
Quote:
... hydrogels of varying Young’s modulus: 5 kPa (4% 20 kDa 4-arm PEG-NB, Creative PEGworks; 2 mM RGD, Genscript), 12 kPa (5% 40 kDa 8-arm PEG-NB ...
-
No products found
because this supplier's products are not listed.
Shene Chiou, et al.,
bioRxiv - Cell Biology 2024
Quote:
... 5% v/v 2-mercaptoethanol) and fractionated by 4-15% Tris-Glycine gel (Bio-Rad Cat#5678084) using Tris-Glycine running buffer (0.2M Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Eriko Watada, et al.,
bioRxiv - Genetics 2020
Quote:
... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
No products found
because this supplier's products are not listed.
Marcia A. Munoz, et al.,
bioRxiv - Physiology 2022
Quote:
... with 0.33mM R,S-[2-14C]mevalonic acid (53mCi/mmol; Perkin Elmer) hydrolysed from the lactone form ...
-
No products found
because this supplier's products are not listed.
Konstadinos Moissoglu, et al.,
bioRxiv - Cell Biology 2020
Quote:
... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
No products found
because this supplier's products are not listed.
Laísa Quadros Barsé, et al.,
bioRxiv - Biochemistry 2024
Quote:
... The resulting filtrate was loaded onto 2 × 5 ml nickel–nitrilotriacetic acid (Ni–NTA) columns “HisTrapTM HP” (GE Healthcare) equilibrated with lysis buffer 2 ...
-
No products found
because this supplier's products are not listed.
Hannah Guak, et al.,
bioRxiv - Immunology 2022
Quote:
... and 5 μM medronic acid (5191-4506, Agilent Technologies). For positive mode analysis ...
-
No products found
because this supplier's products are not listed.
Melanie B. Abrams, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... 0.075% 5-fluorooritic acid (Zymo Research)) ...
-
No products found
because this supplier's products are not listed.
Andrew C. Edmondson, et al.,
bioRxiv - Neuroscience 2024
Quote:
... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
No products found
because this supplier's products are not listed.
Kona N. Orlandi, Michael J. Harms,
bioRxiv - Immunology 2024
Quote:
... 2) 0.2 ng/µL LPS-R (tlrl-eklps; Invivogen) as a positive control for human TLR4 ...
-
No products found
because this supplier's products are not listed.
Jiayi Zhao, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 4’,6-diamidino-2-phenylindole (DAPI) was diluted to 5 μg/mL in Vectashield antifade mounting media (Vector Laboratories).
-
No products found
because this supplier's products are not listed.
Rayan Khaddaj-Mallat, et al.,
bioRxiv - Neuroscience 2021
Quote:
Pericytes viability was assessed using the 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) assay according to the manufacturer’s procedure (Cell Signaling Technology). Cells were plated at the appropriate concentration in 96-well plates under different experimental conditions ...
-
No products found
because this supplier's products are not listed.
Paul Renauer, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 4 x 2 mm (Phenomenex). The eluents were A ...
-
No products found
because this supplier's products are not listed.
Ludovic Enkler, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 2% (w/v) glucose and mixtures of amino acids (MP Biomedicals) depending on the auxotrophies used for selection ...
-
No products found
because this supplier's products are not listed.
Paraskevi Athanasouli, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
No products found
because this supplier's products are not listed.
Sawsan S Alamri, et al.,
bioRxiv - Immunology 2021
Quote:
... were coated overnight at 4°C with the SARS-CoV-2 S1 subunit (amino acids 1–685) (Sino Biological, China) at 1 μg/ml in PBS (50 ul/well) ...
-
No products found
because this supplier's products are not listed.
Gemma Leon, et al.,
bioRxiv - Immunology 2024
Quote:
... stimulated with IL-2 (R&D), and/or T cell differentiating cytokines and antibodies (Th1: anti-IL-4, IL-12 (Miltenyi Biotec), Treg ...
-
No products found
because this supplier's products are not listed.
Kathleen Bates, Kim Le, Hang Lu,
bioRxiv - Bioengineering 2021
Quote:
... gravid day 1 adults animals were picked onto prepared palmitic acid plates and plates were imaged at 2 and 5 hours at 1.6x on a stereomicroscope (Leica M165 FC) using a 1.3 MP CMOS camera (Thorlabs DCC1645C ...
-
No products found
because this supplier's products are not listed.
Peter M. Andrew, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... The O.D./min was continuously recorded at 405 nm over 30 min to measure the hydrolytic product 5-mercapto-2-nitrobenzoic acid using a Synergy H1 microplate reader (Biotek; VT, USA). O.D./min was converted to catalytic rate using the Beer-Lambert law:
-
No products found
because this supplier's products are not listed.
Maria G. Noval, et al.,
bioRxiv - Microbiology 2023
Quote:
... for 5 min and differentiated in 1% acetic acid (Polysciences, 25088f) for 1 min before dehydration and mounting with permount (Fisher ...
-
No products found
because this supplier's products are not listed.
Fatmanur Tiryaki, et al.,
bioRxiv - Cell Biology 2021
Quote:
... for 5 minutes at 4°C with TLA100 rotor (Beckman). 100 µg cell lysate was brought to a final volume of 250 µl BRB80 supplemented with 1 mM GTP ...
-
No products found
because this supplier's products are not listed.
Anthony Flamier, et al.,
bioRxiv - Neuroscience 2023
Quote:
... and passaging every 4-5 days using ReLeSR (StemCell technologies). hES-qualified Matrigel (Corning ...
-
No products found
because this supplier's products are not listed.
Dannielle K. Zierath, et al.,
bioRxiv - Neuroscience 2023
Quote:
... mice (4–5 weeks old; Jackson Labs, Bar Harbor, ME) were group-housed throughout the infection and monitoring period (5/cage) ...
-
No products found
because this supplier's products are not listed.
Valentin Zufferey, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 2D cultures (Fig.1) and live imaging (Fig. 4-5) were acquired with an inverted microscope (Nikon Eclipse Ti-2) equipped with an Okolab cage incubator (H201-T-UNIT) ...
-
No products found
because this supplier's products are not listed.
Peter S. Chang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... for 30 min at 4°C and R-phycoerythrin (PE)-conjugated streptavidin (Jackson ImmunoResearch) for 30 min at 4°C ...
-
No products found
because this supplier's products are not listed.
Alexander J. Knights, et al.,
bioRxiv - Cell Biology 2022
Quote:
... and an anti-R-spondin 2 antibody (ProteinTech) or Rabbit IgG Isotype Control (Abcam ...
-
No products found
because this supplier's products are not listed.
Salman Tamaddon-Jahromi, et al.,
bioRxiv - Cell Biology 2023
Quote:
SKOV-3 cells transfected without or with 100nM siRNA and simultaneously treated with 10μM 5-Aza-Cdr for 4 days were seeded into 2-well cell culture inserts (Ibidi, UK). After cell attachment (6h) ...
-
No products found
because this supplier's products are not listed.
Anjali Bajpai, et al.,
bioRxiv - Genetics 2021
Quote:
... Images containing 5 Z-stacks were captured for quantification (100x magnification) on Axioplan-2 using Axiovision version-4 camera (Carl Zeiss). The intensity of fluorescence of FITC and Cy3 was quantified from the projected images using the LSM-FCS Version 3.2SP software (Carl Zeiss ...
-
No products found
because this supplier's products are not listed.
Francesco Roncato, et al.,
bioRxiv - Cancer Biology 2020
Quote:
... Images were acquired at a rate of one frame every 4-5 min for 4 h using an IX83 inverted microscope (Olympus) equipped with UPlanFLN 20x/0.50 Ph1 ∞/0.17/FN 26.5 objective (Olympus) ...
-
No products found
because this supplier's products are not listed.
Ying Li, et al.,
bioRxiv - Cell Biology 2020
Quote:
... BODIPY-dodecanoic acid fluorescent fatty acid analog was added (QBT™ Fatty Acid Uptake Assay Kit, Molecular Devices) and the plate was immediately transferred to a fluorescence microplate reader for kinetic reading (every 20 seconds for 30-60 minutes ...