Labshake search
Citations for Takara Bio :
1 - 50 of 1220 citations for R 4 5 Isopropylidene 2 pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic recombination assay was performed using PCR primers that flank exons 4-6 of mouse Galnt2 (F: 5’-GTACGTGAGACAGGCCTAAGG-3’ R: 5’-CAAGCTTCATTTAGGACCAAGC-3’) and EmeraldAmp PCR Master Mix (Takara Bio, San Jose, CA). PCR cycling parameters were as follows ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Plant Biology 2020Quote: The 5’ Digoxigenin labeled R-box and non-labeled oligonucleotides were synthesized (Takara, Dalian, China). The binding mixture contained nuclear extracts ...
-
bioRxiv - Plant Biology 2022Quote: ... The qRT-PCR was performed with the reversed cDNAs as substrates and the MeSWEET10a specific primers (F: 5’-TCCTCACCTTGACTGCGCTG-3’; R: 5’-AGCACCATCTGGACAATCCCA-3’) by using the SYBR Premix Taq Kit (TaKaRa, Dalian, China) in the ABI7500 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Neuroscience 2024Quote: ... per reaction and 2 µl of 5 µM SMART PCR primer (Takara Bio). Amplification was performed by incubating tubes on a thermocycler at 98°C for 3 minutes followed by 18 cycles of 98°C for 20 seconds ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Synthetic Biology 2023Quote: ... VH and VL segments were ordered as gene blocks from Integrated DNA Technologies and were cloned into linearized CMV/R backbones with 5× In-Fusion HD Enzyme Premix (Takara Bio).
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Plant Biology 2023Quote: ... The reaction medium contained 2 µL of 5× In-Fusion HD Enzyme Premix (Clontech); 1 µL of linearized pFL61[GFP] (∼100 ng) ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Beta RBD was purified using a 5 mL HisTalon Superflow cartridge (Takara Bio) followed by buffer exchange into PBS using a HiPrep 26/10 desalting column (Cytiva).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μl of the PCR product was treated with 2 μl cloning enhancer (Takara-bio Inc.). The cloning reaction was prepared by adding 2 μl of 5X In-Fusion HD Cloning enzyme mix ...
-
bioRxiv - Immunology 2021Quote: ... wild-type SARS-CoV-2 RBD was purified using a 5 mL HisTALON superflow cartridge (Takara Bio) followed by size exclusion chromatography using a Superdex 200 10/300 GL column pre-equilibrated in 20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biophysics 2021Quote: ... denatured at 85°C for 5 minutes and annealed at 47.5°C for 4 hours in a PCR machine (Takara-Bio). The folded DNA origami was then agarose-gel-purified (Douglas et al ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Physiology 2021Quote: ... mixed with 5 μl lysis buffer (0.2% Triton X-100, with 2 U/μl recombinant RNase inhibitor, Clontech) at the end of the collection and were immediately snap-frozen on dry ice ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg RNase H-treated RNA was poly-A tailed with 2 U of poly(A) polymerase (Takara) for 1 hour at 37 ℃ ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Immunology 2024Quote: ... T cells were activated for 2 days and NK cells were activated for 4 days followed by retronectin (Takara, T100B) mediated viral transduction ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... The bacteria were then collected by centrifugation at 4,000 rpm for 5 min and 2 ml xTractor Buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Neuroscience 2024Quote: ... Lentivirus-containing conditioned media were centrifuged at 500 x g for 5 min at 4°C to remove cellular debris and concentrated using Takara LentiX (Takara Cat# 631231). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Immunology 2023Quote: ... The mixture was then chilled on ice for 2 min and then mixed with 4 μl 5x first-strand buffer (Takara Bio), 2 μl 100 mM DTT ...
-
bioRxiv - Physiology 2022Quote: ... the beads were well-washed by column binding buffer 5 times and then incubated in 2× Protein SDS PAGE Loading (Takara) 100°C for 5 min to completely elute the proteins ...
-
bioRxiv - Molecular Biology 2024Quote: Quantitative real-time PCR was performed in a 10 µL reaction volume containing 5 µL of 2× SYBR Premix Ex Taq (RR420A, Takara), 1 µL of diluted cDNA ...
-
bioRxiv - Biochemistry 2024Quote: ... Gapdh (forward, MA050371-F; reverse, MA050371-R; Takara Bio); and Actb (forward ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Plant Biology 2024Quote: ... RLFcd(H184A)/pENTR by using RLFcds/pENTR as template with H161A-F/H161A-R and H184A-F/H184-R primers using PrimeSTAR Max (Takara Bio Inc., Japan). To construct RLFcd(H161A/H184A)/pENTR ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Transferred RNA was UV-crosslinked to membrane and hybridized with [γ- 32P] 5’-end labeled RFP-spacer specific probe (RFP_crRNA_probe, Supplementary Table 2) in ExpressHyb solution (Clontech Laboratories, Inc) according to manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... were enriched from the lysate by immunoprecipitation using GFP-Trap (Lablead, GNM-25-1000) and were partially digested by micrococcal nuclease (2 × 10−5 U/μL, Takara, 2910A). The digested RNA was ligated to the 3′-RNA adaptor labeled by biotin ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfection medium was replaced with 2 ml of reduced serum culture medium (5% FCS) supplemented with 300 μM A/C heterodimerization agent (formerly AP21967, Takara BioInc), 20 mM HEPES and 10 μM cholesterol (balanced with methyl-β-cyclodextrin ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl of a 1:5 cDNA dilution was used together with forward and reverse primers per each mRNA (2 µM; Supp. Table 1) and 5 µl of SYBR® Premix-Ex-Taq (Tli RNase H Plus, Takara) in a 10 µl reaction ...