-
No products found
because this supplier's products are not listed.
Sara Borghi, et al.,
bioRxiv - Immunology 2020
Quote:
... antibodies were immobilized on Series S Protein L sensor chip (GE Healthcare) at a density of 400 RU and experiments were performed in HBS-EP+ buffer at pH 6.0 following the method described above ...
-
No products found
because this supplier's products are not listed.
Tara MacDonald, et al.,
bioRxiv - Physiology 2024
Quote:
Specific sensor cartridges (Agilent) for all experiments were hydrated >18h at 37°C (no CO2).
-
No products found
because this supplier's products are not listed.
Gaspar A. Pacheco, et al.,
bioRxiv - Immunology 2024
Quote:
... Streptavidin sensors (Sartorius) were loaded with biotinylated natural Ara h 2 (InBio) ...
-
No products found
because this supplier's products are not listed.
Justin Daho Lee, et al.,
bioRxiv - Bioengineering 2024
Quote:
... both sensors expressed in the cells with live cell imaging solution with 10mM glucose (LCIS+, Gibco, A14291DJ) were imaged using an epifluorescence microscope ...
-
No products found
because this supplier's products are not listed.
Santiago R. Unda, et al.,
bioRxiv - Neuroscience 2024
Quote:
... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
No products found
because this supplier's products are not listed.
Mainak Das Gupta, et al.,
bioRxiv - Biochemistry 2022
Quote:
... For capture of antibodies and Fc-Fusions a CM5-S-Series sensor chip (Cytiva) was functionalized with 2500RU recombinant Protein A (Sigma) using EDC/NHS Coupling Kit (Biacore/Cytiva BR-1000-50 ...
-
No products found
because this supplier's products are not listed.
Christina Savva, et al.,
bioRxiv - Physiology 2021
Quote:
... Blood glucose level was measured with a OneTouch Ultra glucometer (AccuChek Sensor, Roche Diagnostics). Subsequently ...
-
No products found
because this supplier's products are not listed.
Sachin G. Chavan, et al.,
bioRxiv - Plant Biology 2022
Quote:
... An additional five PAR sensors (190R-SMV-50 Quantum Sensor, LI-COR) were distributed spatially across each bay to measure light at canopy level during both experimental trials ...
-
No products found
because this supplier's products are not listed.
Sanjana Rajan, et al.,
bioRxiv - Cancer Biology 2022
Quote:
Primary antibodies against glucose transporter 1 (Abcam, ab15309, 1:200), hexokinase 2 (Abcam ...
-
No products found
because this supplier's products are not listed.
Yogesh Hooda, et al.,
bioRxiv - Biochemistry 2024
Quote:
... with the 60 µM sensor (Merck Millipore, PHCC60050). The cells were recovered by centrifugation for 2 min at 5000 rpm in a microcentrifuge ...
-
No products found
because this supplier's products are not listed.
Syed Faaiz Enam, et al.,
bioRxiv - Bioengineering 2022
Quote:
... Glucose consumption (Glucose-Glo, J6021, Promega), Lactate production (Lactate-Glo ...
-
No products found
because this supplier's products are not listed.
Assunta Senatore, et al.,
bioRxiv - Neuroscience 2020
Quote:
... An NLC sensor chip (Bio-rad) was used to immobilize the biotinylated PrP peptides CC123-50 ...
-
No products found
because this supplier's products are not listed.
Rawshan Choudhury, et al.,
bioRxiv - Cell Biology 2020
Quote:
The endotoxin level of FHL-1 recombinant protein preparations was measured using the Toxin Sensor™ Chromogenic LAL Endotoxin Assay Kit (GenScript, NJ, USA), according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Chloé Gapp, et al.,
bioRxiv - Microbiology 2024
Quote:
... pH sensors (VWR pHenomenal 111 ...
-
No products found
because this supplier's products are not listed.
Semira R. Ortiz, et al.,
bioRxiv - Biochemistry 2022
Quote:
... modified glucose-free DMEM (Hyclone) was adjusted to 25 mM glucose with either 1-13C-glucose or 6-13C-glucose (Cambridge Isotope Laboratories). Cells were reverse transfected as described above ...
-
No products found
because this supplier's products are not listed.
Erika Cecon, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Tau-tau sensor molecules interaction was assessed using two monoclonal antibodies against the HA tag (mouse, Biolegend cat. 901514; rabbit, Cell Signaling 3724S), and two PLA probes (anti-rabbit-PLUS ...
-
No products found
because this supplier's products are not listed.
Turan Tufan, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... glucose (BD), oligomycin (Millipore) ...
-
No products found
because this supplier's products are not listed.
Zixiang Wang, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 0.3% glucose (Corning), and 10 ng/mL insulin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Erika Cecon, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Tau-tau sensor molecules interaction was assessed using two monoclonal antibodies against the HA tag (mouse, Biolegend cat ...
-
No products found
because this supplier's products are not listed.
A. Santana-Sánchez, et al.,
bioRxiv - Plant Biology 2021
Quote:
... Protein-specific antibodies raised against Flv3A (Agrisera), PsaB (AS10 695 ...
-
No products found
because this supplier's products are not listed.
Hirotatsu Imai, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Antibodies against ribosomal proteins uL3 (GTX114725, GeneTex), L10a (A305-061A ...
-
No products found
because this supplier's products are not listed.
Takahiro Kawagishi, et al.,
bioRxiv - Microbiology 2022
Quote:
... anti-RV capsid protein mouse monoclonal antibody (Santa Cruz Biotechnology ...
-
No products found
because this supplier's products are not listed.
Neelesh Patra, Guy C. Barker, Mrinal K. Maiti,
bioRxiv - Plant Biology 2024
Quote:
... as well as control plants and a region of interest encompassing the probable Cas9 cut site was amplified using specific primers (Table S11) using Q5 High-Fidelity DNA Polymerase (NEB). Equal amount of PCR products from putative transgenic plant and respective control plant were mixed and then denatured and reannealed ...
-
No products found
because this supplier's products are not listed.
Zharko Daniloski, et al.,
bioRxiv - Genetics 2020
Quote:
... Loaded sensors were dipped into recombinant SARS-Cov-2 His-tagged Spike protein (D614 or D614G, Sino Biological, Cat # 40591-V08H and 40591-V08H3).
-
No products found
because this supplier's products are not listed.
Zhaofa Wu, et al.,
bioRxiv - Neuroscience 2020
Quote:
... cells expressing candidate GRABAdo sensors were plated in 96-well plates (PerkinElmer).
-
No products found
because this supplier's products are not listed.
Zhenglin Zhu, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Antibodies against Glucose transporter 1 (GLUT1) (ABclonal, A11727), Hexokinase-2 (HK2 ...
-
No products found
because this supplier's products are not listed.
Dilip Challa, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Capture sensor-chip was prepared by covalently immobilizing goat anti-human IgG capture antibodies (Jackson ImmunoResearch) onto a HC30M chip using a standard amine-coupling procedure ...
-
No products found
because this supplier's products are not listed.
Lydia-Ann L.S. Harris, et al.,
bioRxiv - Cell Biology 2021
Quote:
... rabbit polyclonal antibody against Golgi SNARE protein (GS28 Antibody) from Proteintech™ (Chicago ...
-
No products found
because this supplier's products are not listed.
Tsuyoshi Waku, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... HCT116 cells were transfected with the proteasome sensor vector (Clontech). To generate NRF3- and GFP-overexpression cells ...
-
No products found
because this supplier's products are not listed.
Lorena Sanchez Felipe, et al.,
bioRxiv - Microbiology 2020
Quote:
... and HRP conjugated secondary antibody (Protein Simple). Chemiluminescence signals were analyzed using Compass software (Protein Simple) ...
-
No products found
because this supplier's products are not listed.
Aurelien Chuard, et al.,
bioRxiv - Microbiology 2024
Quote:
... 58K Golgi Protein Antibody (Novus Biological #NB600-412SS) was diluted to 1/200 in PBS-BSA (0.5%)-Triton (0.1% ...
-
No products found
because this supplier's products are not listed.
Trey Farmer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Antibodies against the following proteins were used: RPL3 (Bethyl Laboratories #A305-007A,1:100 for immunofluorescence) ...
-
No products found
because this supplier's products are not listed.
Bridget M Curran, et al.,
bioRxiv - Neuroscience 2024
Quote:
... rabbit anti Red Fluorescent Protein (RFP) polyclonal antibodies (Rockland Antibodies, 200-101-379, 1:1000). For NF staining ...
-
No products found
because this supplier's products are not listed.
Dorota Raj, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Proteins were detected using anti-GFP antibody (3H9, Chromotek) or anti-alpha tubulin (T5168 ...
-
No products found
because this supplier's products are not listed.
Yelena Sargsyan, et al.,
bioRxiv - Biochemistry 2020
Quote:
Cells (200,000 for HeLa and hiPSC-CMs and 500,000 for NRCMs) were seeded on glass cover slips and transfected with sensor plasmids using Effectene (Qiagen) (HeLa ...
-
No products found
because this supplier's products are not listed.
Vlada V. Zakharova, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... The DNA-protein-antibody complexes were captured by DiaMag protein A-coated magnetic beads (Diagenode; Cat#: C03010020) by incubating at 4 °C for 2 hours ...
-
No products found
because this supplier's products are not listed.
Clara Morral, et al.,
bioRxiv - Cell Biology 2023
Quote:
... slides were incubated with antibodies to p53 protein (CM5) (Leica Biosystems), EpCAM (CD326 ...
-
No products found
because this supplier's products are not listed.
Tom Rankenberg, et al.,
bioRxiv - Plant Biology 2023
Quote:
... Protein-DNA complexes were immunoprecipitated using anti-HA antibodies (Miltenyi Biotec) (Kaufmann et al. ...
-
No products found
because this supplier's products are not listed.
Minyue Qiu, et al.,
bioRxiv - Immunology 2022
Quote:
... All monoclonal antibodies and recombinant mouse CD274 protein were purchased from R&D Systems (USA).
-
No products found
because this supplier's products are not listed.
Katharina Kases, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... antibodies in Protein LoBind tubes (Eppendorf). Thereafter ...
-
No products found
because this supplier's products are not listed.
Silvio Schmidt, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Primary antibodies against the activity-regulated cytoskeleton-associated protein (ARC; guinea pig, Synaptic system), the glial fibrillary acidic protein (GFAP ...
-
No products found
because this supplier's products are not listed.
Xinyi Zhang, et al.,
bioRxiv - Cell Biology 2024
Quote:
... but with different rabbit polyclonal antibodies from the Human Protein Atlas (HPA) purchased from Atlas Antibodies. On the next day ...
-
No products found
because this supplier's products are not listed.
Gaurav V. Sarode, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Coupled antibody-Dynabeads were prepared by adding Dynabeads protein A/G and 2 μg antibody [H3K9ac (Active Motif) or H3K27ac (Abcam)] to 100 μl ice-cold dilution buffer and rotating the tubes end-over-end at 4°C for 1 hour ...
-
No products found
because this supplier's products are not listed.
Sunil Yeruva, et al.,
bioRxiv - Cell Biology 2023
Quote:
... DSG2 and DSG3-Fc proteins and N-CAD-Fc protein were detected with the following antibodies: mouse-anti-DSG2 (#BM5016, Origene, 1:200); mouse-anti-DSG3 5G11 (#32-6300 ...
-
No products found
because this supplier's products are not listed.
Rebekah L. Rashford, et al.,
bioRxiv - Neuroscience 2024
Quote:
... (3) Incubating the slices in primary antibody [1:500 Anti-Green Fluorescent Protein (Chicken) Antibody (Aves Labs); 1:150 SETD7 Mouse Monoclonal Antibody (OriGene) ...
-
No products found
because this supplier's products are not listed.
Yanchun Zhang, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... Proteins were detected with horseradish peroxidase (HRP)-conjugated secondary antibodies (Jackson Laboratory) and ECL (Pierce).
-
No products found
because this supplier's products are not listed.
Gustavo A. Gomez, et al.,
bioRxiv - Genetics 2022
Quote:
... Protein expression was detected by species-specific secondary antibodies (VECTOR labs, DI-3088, and DI-1794), followed by DAPI (D1306 ...
-
No products found
because this supplier's products are not listed.
Yinan Xiao, et al.,
bioRxiv - Microbiology 2024
Quote:
The protein-DNA and protein-protein interaction were assayed by microscale thermophoresis (MST) using Monolith NT.115 (NanoTemper Technologies, Germany) as described earlier (Su et al ...
-
No products found
because this supplier's products are not listed.
Wonkyung Oh, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... was coated with hPD-L1-His protein and anti-PD-L1 antibody and anti-mouse IgG specific HRP conjugated secondary antibodies (SouthernBiotech, Birmingham, AL, USA) were added ...
-
No products found
because this supplier's products are not listed.
James T. Van Leuven, et al.,
bioRxiv - Microbiology 2021
Quote:
... Antibodies specific for PR8 hemagglutinin protein (NR-3148, BEI Resources) and Ly6G (1A8, Bio X Cell) were detected with immPACT vector red and immPACT DAB ...