Labshake search
Citations for Addgene :
1 - 50 of 484 citations for Probable glucose sensor protein SLC5A4 SLC5A4 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Biophysics 2024Quote: The RhoA sensor construct was made by recombining commercial RhoA sensor plasmid from Addgene into the LZBob-neo-vector ...
-
bioRxiv - Cancer Biology 2022Quote: CMV pCalpain-sensor (Addgene #36182) composed of eCFP (donor ...
-
bioRxiv - Cell Biology 2020Quote: ... Genetically-encoded sensors for glutamate (Addgene) (GltI253-cpGFP.L1LV/L2NP ...
-
bioRxiv - Cell Biology 2024Quote: Peredox NADH/NAD+ sensor (Cat# 163060, Addgene) was transfected into HEK293 cells for lentivirus production ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Cell Biology 2020Quote: The cytosolic roGFP2 sensor was cloned from Addgene 49435 into a retroviral backbone pLPCX by Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... MaLionR ATP sensor was obtained from Addgene (#113908) (Arai et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of the EPAC sensor (Addgene #61622) were mixed with 0.2 µL of lipofectamine 2000 following the transfection method previously described ...
-
bioRxiv - Physiology 2024Quote: ... and mitochondrial redox sensors were obtained from Addgene (plasmid # 102551 ...
-
bioRxiv - Neuroscience 2023Quote: ... or GRABDA DA sensor (AAV9-hSyn-GRAB-DA2m; Addgene # 140553; (33)) using the following stereotaxic coordinates ...
-
bioRxiv - Microbiology 2024Quote: ... for the c-di-GMP sensor system purchased from Addgene (#182291), the plasmid origin was substituted with the p15A ori.
-
bioRxiv - Biophysics 2020Quote: The FRET-based VE-Cadherin tension sensor (VE-CadTS: (Addgene Plasmid# 45848) was used to measure tension on VE-cadherin bonds ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Neuroscience 2021Quote: ... The ecAT3.10 sensor was a gift from Mathew Tantama (Addgene plasmid #107215). The SF-iGluSnFR.A184V sensor was a gift from Loren Looger (Addgene plasmid #106175) ...
-
bioRxiv - Cell Biology 2023Quote: ... The pH sensor superfolder pHluorin (sfpHluorin) amplified from p426MET25-sfpHluorin (Addgene #115697) 43 were expressed from leu1 locus under pil1 promoter.
-
bioRxiv - Molecular Biology 2022Quote: ... PKC sensor pcDNA3-ExRai-CKAR was a gift from Jin Zhang (Addgene plasmid # 118409 ...
-
bioRxiv - Neuroscience 2024Quote: We measured dopamine release using fiber photometry and GRABDA sensors (AddGene #140554). We injected AAV9-hsyn-GRAB DA2h to drive expression of the GRAB sensor ...
-
bioRxiv - Neuroscience 2021Quote: The pm-iATPSnFR1.0 sensor was a gift from Baljit Khakh (Addgene plasmid #102548). The ecAT3.10 sensor was a gift from Mathew Tantama (Addgene plasmid #107215) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SF-iGluSnFR.A184V sensor was a gift from Loren Looger (Addgene plasmid #106175). The Rncp-iGluSnFR sensor was a gift from Robert Campbell (Addgene plasmid #107336 ...
-
bioRxiv - Neuroscience 2021Quote: ... The Rncp-iGluSnFR sensor was a gift from Robert Campbell (Addgene plasmid #107336) and was subcloned into the pAAV-hSyn vector ...
-
bioRxiv - Cell Biology 2023Quote: ... The cytosolic ATP sensor cyto-iATPSnFR1.0 was a gift from Baljit Khakh (Addgene plasmid# 102550 ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDK1 FRET sensor was a gift from Jonathon Pines (Addgene plasmid # 26064). They were subcloned in the pCDNA 3.1 vector containing a T7 promoter and the constancy was confirmed via DNA sequencing ...
-
bioRxiv - Neuroscience 2024Quote: To induce expression of the calcium sensor GCaMP6f (pENN.AAV1.CamKII.GCaMP6f.WPRE.SV40; Addgene cat# 100834) was unilaterally injected in MD (200 μL ...
-
bioRxiv - Developmental Biology 2024Quote: ... we used the PIP-FUCCI sensor by Grant et al.21 (Addgene plasmid #118621) and amplified it with overlaps for a piggyBAC vector45 containing a CAG promoter and a puromycin resistance cassette ...
-
Sexual dimorphism of insular cortex function in persistent alcohol drinking despite aversion in micebioRxiv - Neuroscience 2023Quote: A viral vector coding for the calcium sensor GCaMP6f (AAV9-CaMKII-GCaMP6f-WPRE-SV40, Addgene) was injected unilaterally (250 nl ...
-
bioRxiv - Cell Biology 2021Quote: The genetically encoded calcium sensor pRSET-RcaMP1h was a gift from Loren Looger (Addgene plasmid # 42874). The coding sequence of the RcaMP1h sensor was subcloned into the pShuttle vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Hippocampal area CA1 was injected with a GRABNE NE sensor (AAV9-hSyn-GRAB_NE1m; Addgene #123308; (32)) or GRABDA DA sensor (AAV9-hSyn-GRAB-DA2m ...
-
bioRxiv - Microbiology 2024Quote: The calcium sensor GCamp6f was amplified using primers MLa462/MLa464 from pGP-CMV-GCamp6f plasmid (Addgene) and cloned AvrII/XmaI in the pARL2-GFP vector (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The sensing domain for glucose comprised residues 24–328 of the bacterial D-galactose-binding periplasmic protein (MglB) (Addgene plasmid #163115). Site saturation mutagenesis was carried out according to a previous protocol (Liu & Naismith ...
-
bioRxiv - Cell Biology 2023Quote: ... The cytosolic ATP sensor cyto-iATPSnFR1.0 was a gift from Baljit Khakh (Addgene plasmid# 102550; http://n2t.net/addgene:102550; RRID:Addgene_102550) (Lobas et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... Syn-driven GCaMP6f as a calcium sensor was delivered to neurons via AAV9 viral vector transfection (Addgene, pAAV.Syn.GCaMP6f.WPRE.SV40 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sensor plasmids used in this study comprised the following: D1ER (Palmer et al., 2004) (Addgene plasmid #36325) for measurement of [Ca2+]ER and 4mtD3cpV (Palmer et al. ...
-
bioRxiv - Biochemistry 2022Quote: HEK293T cells were transiently transfected with pGP-CMV-GcAMP6s (Ca2+ Sensor plasmid, Addgene, Cat. no. 40753; 4 µg), 5HT2c receptor (as positive control ...
-
bioRxiv - Neuroscience 2022Quote: ... DV: −5.8 mm) with an adeno-associated viral vector conveying the genetically encoded calcium sensor jGCaMP7s (#104491, Addgene) into the SCN and a gradient index lens 0.50 mm in diameter (1050-004611 Inscopix ...
-
bioRxiv - Neuroscience 2021Quote: ... For fiber photometry recordings wildtype mice were injected into the NAc with an AAV encoding the dopamine sensor dLight (AAV2.5-CAG-dLight1.1, Addgene). Afterwards a gradient refractive index (GRIN ...
-
bioRxiv - Molecular Biology 2022Quote: ... PKC sensor pcDNA3-ExRai-CKAR was a gift from Jin Zhang (Addgene plasmid # 118409 ; http://n2t.net/addgene:118409 ; RRID:Addgene_118409). Constitutively active CaMKI (pTwistCMV-CAMK1T177D ...
-
bioRxiv - Neuroscience 2023Quote: ... Polycistronic CRISPR plasmids pX33075 and pX45876 were optimized so that one vector contained two U6 promotors with two sgRNA sequences.39 Guide RNA sequences were chosen as described.77,78 The DNA sequence encoding the TagRFP-T_A1aY1 Tyr-T sensor was amplified from Addgene plasmid #158751 (a gift from Minhajuddin Sirajuddin43 ...
-
bioRxiv - Neuroscience 2023Quote: Rats were infused bilaterally with AAV encoding the GPCR-activation-based dopamine sensor GRABDA2h (pAAV9-hsyn-GRAB_DA2h, Addgene) or control fluorophore (AAV8-hSYN-GFP) ...
-
bioRxiv - Cell Biology 2023Quote: ... was performed to move the RhoA FRET sensor fragment into the doxycycline-inducible pInducer20 vector (Addgene plasmid # 44012).
-
bioRxiv - Neuroscience 2024Quote: ... Horizon) according to manufacturer’s instructions and with 1.125 µg/mL tyrosinated tubulin sensor TagRFP-T AlaY1 (158751; Addgene) (Kesarwani et al. ...
-
bioRxiv - Cell Biology 2020Quote: The calcium sensor (pGP-CMV-GCaMP6f) used in this study was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 40755 ...
-
bioRxiv - Cell Biology 2021Quote: ... The adenovirus was constructed by subcloning the existing E-cadherin tension sensor into the pShuttle-CMV vector (Addgene, 16403), followed by recombination into the pAdEasy1 vector (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... The GRX1-roGFP2 sensor(48, 78) was amplified from the commercially available vector pEIGW-GRX1-roGFP2 (Addgene plasmid nº64990) using primers 1/2 and insert into digested (HF-EcoRI & PacI ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203; http://n2t.net/addgene:45203; RRID:Addgene 45203). Cells were transiently transfected with a and plated onto glass-bottom plates ...
-
bioRxiv - Molecular Biology 2022Quote: ... in 6-well plates (1.5×106 cells/well) and co-transfected with the cAMP sensor Pink Flamindo (Addgene plasmid #102356) and either empty vector or the given GPR126 construct in the pULTRA vector on the next day using Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
Real-time activity of dynorphin-expressing neurons in mouse central amygdala during alcohol drinkingbioRxiv - Neuroscience 2024Quote: Mice underwent unilateral surgical delivery of a Cre-dependent GCaMP7f calcium sensor into the CeA (pGP-AAV1-syn-FLEX-jGCaMP7f-WPRE, a gift from Douglas Kim & GENIE Project, Addgene viral prep # 104492-AAV1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Entry vector for: mito-roGFP2-Orp1 H2O2 oxidation sensor (mitochondrial), a gift from Adam Cohen (Werley et al., 2020) (Addgene plasmid # 163076 ...