Labshake search
Citations for New England Biolabs :
1 - 50 of 1089 citations for Probable glucose sensor protein SLC5A4 SLC5A4 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... as well as control plants and a region of interest encompassing the probable Cas9 cut site was amplified using specific primers (Table S11) using Q5 High-Fidelity DNA Polymerase (NEB). Equal amount of PCR products from putative transgenic plant and respective control plant were mixed and then denatured and reannealed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Laconic sensor mRNA was synthesised from pCS2 plasmids linearised with NotI (NEB), with mMESSAGE mMACHINE SP6 Transcription Kit (Ambion ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the barcode and sensor regions of the biosensor libraries were amplified using Q5 PCR (New England Biolabs) directly off 5 μL of glycerol stock using primers p117 and p118 (Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: Sensor constructs were amplified by a standard Q5® High-fidelity DNA-Polymerase protocol (New England Biolabs) using oligonucleotides (Table S6 ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-Maltose Binding Protein monoclonal antibody IgG2a (New England Biolabs), mouse anti-Histone H3 [Trimethyl Lys9] 6F12-H4 (Novus Biologicals) ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were then coupled to protein G beads (New England Biolabs). After beads were washed ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were detected using anti-MBP antibody (anti-MBP NEB e8032s) and HRP conjugated secondary antibody ...
-
bioRxiv - Biochemistry 2024Quote: Initial sensor construction was conducted by a two-step splicing overlap extension PCR with Phusion polymerase (New England Biolabs) using standard protocol with an adjusted elongation time of 50 s ...
-
bioRxiv - Cell Biology 2020Quote: ... Interacting MBP-AtPIP5K2 protein was detected using an anti-MBP antibody (NEB). Protein input was detected using an anti-GST antibody (GE Healthcare).
-
bioRxiv - Biochemistry 2020Quote: ... was produced by cloning five synthetic gene fragments in pE-SUMO (Life Sensors, PA) using NEBuilder HiFi DNA Assembly (New England Biolabs). For purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... The ubl-1::mCherry::pri-mir-58-sensor-mut mutation was introduced into the CMP1 ubl-1::mCherry::pri-mir-58-sensor plasmid using NEB Q5 site directed mutagenesis (New England Biolabs, E0554S) with the primers GGGATGAGATTGTTCAGTACG and TATGGTATTGGACGAAGTG ...
-
bioRxiv - Biochemistry 2021Quote: ... 1μL m6A antibody per sample was coupled to pre-washed Protein G Magnetic Beads (NEB) in 1x reaction buffer (150mM NaCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... The antibodies were captured using 50 µl of protein G magnetic beads (S1430, New England Biolabs) incubated for 60 min with end over end mixing at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... The lysate-antibody mix was then incubated with Magnetic Protein A beads (New England Biolabs, S1425S) overnight at 4 °C with end over rotation ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg antibody (Table. S3) and 50 µl protein A magnetic beads (New England Biolabs, Cat. No. S1425S) were added to the supernatant and incubate overnight at 4 degree Celsius ...
-
bioRxiv - Microbiology 2020Quote: ... glabrata total cell lysates using the anti-Rad53 antibodies described in the previous section and Protein A magnetic beads (New England Biolabs). The immunoprecipitated samples were run on 8% acrylamide gels ...
-
bioRxiv - Molecular Biology 2024Quote: ... 0.5% Nonidet P-40) and incubated with pre-washed anti-D-lactyllysine antibody-conjugated protein A agarose beads (PTM Biolabs) at 4 °C overnight ...
-
bioRxiv - Biochemistry 2022Quote: ... protein was treated overnight with Lambda Protein Phosphatase (NEB #P0753S) at 4 °C.
-
bioRxiv - Neuroscience 2021Quote: ... Cas9 protein (NEB) was mixed with all six sgRNAs and injected into embryos at the 1-cell stage ...
-
bioRxiv - Plant Biology 2024Quote: ... SpCas9 protein (NEB), 1 x cut smart buffer (NEB) ...
-
bioRxiv - Plant Biology 2022Quote: ... the particles were captured by magnetic stand and proteins captured by the particles were separated by SDS-PAGE and examined by immunoblotting using MBP antibody (NEB, #E8032S). For the immunoblot ...
-
bioRxiv - Genomics 2021Quote: ... the gDNA mixture was glucosylated using UDP-glucose and T4 ꞵ-glucosyltransferase (T4-ꞵGT, NEB M0357S) at 37°C for 1h ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were then mixed with Blue Protein Loading Dye (NEB) boiled for 10 minutes and separated on 10% SDS-PAGE gel for 50 minutes at 140 V ...
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used 50 μL Protein A or Protein G Magnetic beads (NEB) and washed twice with PBS with 5 mg/ml BSA and 4 μg of antibody coupled in 500 μl PBS with 5 mg/ml BSA overnight at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Lambda Protein Phosphatase (NEB) assay was performed as described by the supplier ...
-
bioRxiv - Biochemistry 2020Quote: ... Cas9 protein (NEB M0641S) and phenol red injection dye ...
-
bioRxiv - Developmental Biology 2021Quote: Cas9 protein (M0646, NEB) and sgRNAs against antisense of exons 14 ...
-
bioRxiv - Cell Biology 2024Quote: ... λ- Protein Phosphatase (NEB) or 500 µM ATP was added and samples were incubated at 30 °C for 30 minutes.
-
bioRxiv - Plant Biology 2021Quote: Purified LPR1 protein was analyzed using Protein Deglycosylation Mix II (New England Biolabs) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein (200 µg) was precleared with protein G magnetic beads (New England Biolabs) and incubated overnight (4° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cleaved G protein was dephosphorylated by lambda protein phosphatase (NEB, Frankfurt, Germany), calf intestinal phosphatase (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... The protein ladder used was Colour Protein Standard Broad Range (NEB, Ipswich, US).
-
bioRxiv - Plant Biology 2024Quote: ... 2µg of recombinant protein was mixed with 400U lambda protein phosphatase (NEB, #P0753S) at 30°C for 30 min before separated by an SDS-PAGE ...
-
bioRxiv - Genomics 2023Quote: ... The end-tagged DNA was oxidized in 15 μL BGT reaction mix (0.3 μL Uridine Diphosphate Glucose (NEB), 1.5 μL NEBuffer 4 (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... Protein molecular ladder (Color Prestained Protein Standard, Broad Range 11–245 kDa, NEB, P7712S). Dry transfer was performed using an iBlot™ 2 gel transfer device (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... purified proteins were directly digested by O-glycosidase (P0733, NEB, 4,000 units/µg protein) and α2-3 ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extracts were also treated with Lambda Protein Phosphatase (Lambda PP, New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... 15µl to 25µl of extracted proteins in NuPAGE buffer and 0.5µl protein ladder (BioLabs) were loaded into a Bio-Rad 4-15% Mini-PROTEAN precast polyacrylamide gel ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein expression was performed with the PURExpress In Vitro Protein Synthesis kit (E6800, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lambda protein phosphatase (λPP) (NEB) was used to dephosphorylate the purified chromatin ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1.9nM Cas9 protein (NEB M0386T) and 14% Phenol Red ...
-
bioRxiv - Biochemistry 2022Quote: ... Lambda protein phosphatase (P0753, NEB), AZD8055 (S1555 ...
-
bioRxiv - Immunology 2022Quote: ... Protein G magnetic beads (NEB) were incubated with anti-2A (Novus ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Cas9 protein (NEB, M0646), and 200 ng/ul of guide RNA ...
-
bioRxiv - Bioengineering 2024Quote: ... coli Protein Synthesis System (NEB) [48] at 2 x the reaction scale ...
-
bioRxiv - Molecular Biology 2024Quote: ... Protein Deglycosylation Mix II (NEB) was added and further incubated for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Protein Kinase K (NEB) and incubated at 37 °C for 1 h ...