-
No products found
because this supplier's products are not listed.
Julian Schmitz, et al.,
bioRxiv - Bioengineering 2021
Quote:
Shake flask cultivation was performed as triplicates in 125 mL shake flasks (Flat Base, TriForest, USA) with a cultivation volume of 60 mL ...
-
No products found
because this supplier's products are not listed.
Verena Haage, et al.,
bioRxiv - Neuroscience 2024
Quote:
... 100 ng/mL CD200 (Bon Opus Biosciences) and 100 ng/mL CX3CL1 (R&D Systems ...
-
No products found
because this supplier's products are not listed.
Jessica B. Blackburn, et al.,
bioRxiv - Cell Biology 2021
Quote:
... 25 μg of SIgA was incubated with 10 μg sputum-derived human neutrophil elastase (1 ug/uL in 0.05 M NaOAc pH 5 containing 0.1 M NaCl, Elastin Products Company, SE563GI) with or without a protease inhibitor (Sigma ...
-
No products found
because this supplier's products are not listed.
Jan A. Veenstra,
bioRxiv - Zoology 2023
Quote:
... Peptides with an N- or C-terminal cysteine were conjugated through this residue using 4-(N-Maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxysuccinimide ester (AK Scientific, Inc., Union City, CA 94587, USA) to bovine serum albumin (BSA) ...
-
No products found
because this supplier's products are not listed.
Leila Revollo, et al.,
bioRxiv - Cell Biology 2021
Quote:
... anti p-VLK (Y64) raised against epitope GRGELARQIRERYEEVQRYSRG phosphorylated at Y64 of mouse VLK (Abfrontier), anti cytoplasmic actin (Milipore Sigma ...
-
No products found
because this supplier's products are not listed.
Giovanni de Nola, et al.,
bioRxiv - Bioengineering 2022
Quote:
... non-migrated cells were removed, the cells migrated over the collagen coated (100 μg/mL Purecol, Nutacon) 8 μm pore-size membrane (Neuro Probe) were fixed in 4% paraformaldehyde in PBS and stained using HCS CellMask™ Green stain (ThermoFisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Yuhan Jiang, et al.,
bioRxiv - Biochemistry 2023
Quote:
... 75 µL of the cell lysate was mixed with 100 µL of 70% nitric acid (Fisher chemical, Cat# A509P212) in 15 mL metal-free tube (Labcon, Cat# 3134-345-001-9). The samples were heated in 60°C water bath for 1 h to make sure the sample is fully digested ...
-
No products found
Suchitra Joshi, et al.,
bioRxiv - Neuroscience 2023
Quote:
The serum progesterone levels (n=4) were measured using an ELISA assay (# K025-H1/H5 Arbor Assays, Ann Arbor ...
-
No products found
because this supplier's products are not listed.
Rida Rehman, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Rabbit anti-HELLS (1:100, Antibodies.com), Rat anti-Vitronectin (1:100 ...
-
No products found
because this supplier's products are not listed.
Sophie E. Cousineau, et al.,
bioRxiv - Microbiology 2022
Quote:
... slides were fixed in 100% acetone and stained with anti-HCV core antibody (1:100, clone B2, Anogen), and subsequently with the AlexaFluor-488-conjugated anti-mouse antibody (1:200 ...
-
No products found
because this supplier's products are not listed.
Peng V. Wu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... CK19 (rabbit, 1:100, Abbomax 602-670), Ki-67 (rat ...
-
No products found
because this supplier's products are not listed.
Galina A. Gusarova, et al.,
bioRxiv - Physiology 2021
Quote:
... we synthesized nitrilotriacetic acid (NTA) to the N-terminus of TAT (amino acids 48-60, CHI Scientific, Maynard, Mass.). Then ...
-
No products found
because this supplier's products are not listed.
Niraj Mishra, et al.,
bioRxiv - Microbiology 2019
Quote:
... they were resuspended in FACS-B and filtered through 100 μm nylon meshes (Sefar, ELKO Filtering, 03-100/44) prior to analysis on a flow cytometer (LSR Fortessa X-20 ...
-
No products found
because this supplier's products are not listed.
Haris Babačić, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Spectra were then searched in the Galaxy framework using tools from the Galaxy-P project (Boekel et al., 2015; Goecks et al., 2010), including MSGF+ (Kim and Pevzner ...
-
No products found
because this supplier's products are not listed.
Igor P. Oscorbin, et al.,
bioRxiv - Molecular Biology 2020
Quote:
... 100 U of T7 RNA polymerase (SibEnzyme, Russia), 1× reaction buffer (50 mM Tris-HCl ...
-
No products found
because this supplier's products are not listed.
Liang Li, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... Sheep anti- Chx10 (Exalpha Biologicals, X1179P, 1:100), Gunine Pig anti-RBPMS (PhosphoSolutions ...
-
No products found
because this supplier's products are not listed.
Rita R. Fagan, et al.,
bioRxiv - Neuroscience 2020
Quote:
... and N-S/DAT and S/DAT/S were detected with amino-directed mouse anti-hSERT (MAb Technologies,1:2000). Immunoreactive bands were detected using a VersaDoc imaging station (Bio-Rad) ...
-
No products found
because this supplier's products are not listed.
Ariane C. Scheuren, et al.,
bioRxiv - Physiology 2020
Quote:
... Markers for bone formation and resorption were measured in technical duplicates using ELISA kits for N-terminal propeptide of type I procollagen (PINP, AC-33F, Immunodiagnostics) and for C-terminal cross-linked telopeptides of type I collagen (CTX-I ...
-
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Thomas S. McAlear, Susanne Bechstedt,
bioRxiv - Biophysics 2021
Quote:
... polymerase and inserted into a modified pHAT vector containing an N-terminal 6xHis-tag with and without a carboxy-terminal mNeonGreen (Allele Biotech) followed by a Strep-tag II (Bechstedt and Brouhard ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Megan S. Reich, et al.,
bioRxiv - Evolutionary Biology 2023
Quote:
... The separation of Sr was processed in a 100 µL microcolumn loaded with Sr-spec Resin (100 - 150 µm; Eichrom Technologies, LLC). The matrix was rinsed out using 6 M HNO3 ...
-
No products found
because this supplier's products are not listed.
Amalie Carnbring Bonde, et al.,
bioRxiv - Biochemistry 2021
Quote:
The effect of the FX/FXa N-glycan variants on thrombin generation was measured in FX-depleted plasma (Affinity Biologicals, Ontario, Canada) supplemented with neutralizing FVIII antibodies ...
-
No products found
because this supplier's products are not listed.
Manuel García-Jaramillo, et al.,
bioRxiv - Animal Behavior and Cognition 2020
Quote:
... and their precursor dopamine were measured in fish (n=12) using the 3-CAT ELISA (Rocky Mountain Diagnostics, Inc., Colorado Springs, CO) per manufacturer’s recommendations ...
-
No products found
because this supplier's products are not listed.
Marina Johnson, et al.,
bioRxiv - Immunology 2020
Quote:
Samples were screened for IgG to SARS-CoV-2 N protein using a commercially available kit (Epitope Diagnostics Inc, San Diego, USA) as previously described (8).
-
No products found
because this supplier's products are not listed.
Danielle G. May, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... chicken anti-BioID2 (1:5000; BID2-CP-100; BioFront Technologies) or mouse anti-hemagglutinin primary antibody was used (HA ...
-
No products found
because this supplier's products are not listed.
Sandrine Valade, et al.,
bioRxiv - Immunology 2021
Quote:
... VWF antigen (Ag) (N: 50-150 IU/dL) was measured using the automated STA-Liatest VWF:Ag® (Diagnostica Stago, Asnières-sur-Seine, France). ADAMTS13 activity (N ...
-
No products found
because this supplier's products are not listed.
Mohammed N.A. Siddiquey, et al.,
bioRxiv - Microbiology 2020
Quote:
... 10 μg/mL ciprofloxacin (Genhunter), and either 5% fetal bovine serum (FBS ...
-
No products found
because this supplier's products are not listed.
André Folgado, Rita Abranches,
bioRxiv - Plant Biology 2021
Quote:
... Protein bands were identified using the Edman reaction and a Procise 491 HT Protein Sequencer to determine the N-terminal sequences (Analytical Laboratory, Analytical Services Unit, ITQB NOVA).
-
No products found
because this supplier's products are not listed.
Daniel Z. Radecki, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Lentivirus pellet was then resuspended in 100□l LentiGuard reagent (Cellomics) and stored at -80⁰C until use ...
-
No products found
because this supplier's products are not listed.
Vipul Sharma, et al.,
bioRxiv - Developmental Biology 2020
Quote:
... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
No products found
because this supplier's products are not listed.
Thomas A. Desautels, et al.,
bioRxiv - Microbiology 2023
Quote:
... diluted to 50-100 nM in RexxipF buffer (Gyros Protein Technologies). Resulting values were fit to a 4PL model or calculated as area under the curve (AUC ...
-
No products found
because this supplier's products are not listed.
Tianzi Zhang, et al.,
bioRxiv - Bioengineering 2020
Quote:
... 10 μg/mL ECGS (Cell Biologics), 50 ug/mL heparin (Sigma) ...
-
No products found
because this supplier's products are not listed.
Ravi K. Patel, et al.,
bioRxiv - Immunology 2023
Quote:
... crude collagenase (0.2 mg/ml; Crescent Chemical), and DNase I (0.02 mg/ml ...
-
No products found
because this supplier's products are not listed.
Deirdre Nolfi-Donegan, et al.,
bioRxiv - Cell Biology 2021
Quote:
... collagen (0-50 μg/ml, Bio/Data Corporation), thrombin enzyme (0.1 U/ml ...
-
No products found
because this supplier's products are not listed.
Lucie Peskova, et al.,
bioRxiv - Molecular Biology 2020
Quote:
At least 12 pooled retinal organoids per sample were homogenised using a 1 ml insulin syringe in 1 ml RNA Blue Reagent (an analogue of Trizol) (Top-Bio), followed by chloroform RNA extraction ...
-
No products found
because this supplier's products are not listed.
Mireia Montaner, et al.,
bioRxiv - Physiology 2023
Quote:
... Blood cells were removed from plasma by centrifugation in order to assay plasma insulin (ng/mL) and C-peptide (ng/mL) with a wide-range Ultra Sensitive Mouse Insulin ELISA Kit (catalog no. 90080; Crystal Chem, Inc.) and Mouse C-Peptide ELISA Kit (catalog no ...
-
No products found
because this supplier's products are not listed.
Emely V. Zeledon, et al.,
bioRxiv - Pharmacology and Toxicology 2024
Quote:
... Meals consisted of 1.5 mL sheep blood (Hemostat Laboratories), saline (400 mM NaHCO3 + dih2O) ...
-
No products found
because this supplier's products are not listed.
Laura Frohn, et al.,
bioRxiv - Physiology 2023
Quote:
... Samples were then incubated with 100 µL of anti-rainbow-trout IgM monoclonal antibody (Aquatic Diagnostic Ltd. ...
-
No products found
because this supplier's products are not listed.
Mayank Verma, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... 1 µg/ml anti-FLT1 monoclonal antibody (Angio-Proteomie, MAB7072), inhibitors of FLK1 ...
-
No products found
because this supplier's products are not listed.
K Pilarzyk, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Antibodies were mixed in PBT at optimized dilutions: PDE11A (FabGennix PD11-112 at 1:100; Aves custom PDE11A4 #1 at 1:10,000; Fabgennix PPD11A-140AP at 1:1000 ...
-
No products found
because this supplier's products are not listed.
Hannah A. Pizzato, et al.,
bioRxiv - Immunology 2023
Quote:
CHO cells were incubated with 1µg/mL anti-CHO antibody (Cygnus Technologies) for 30min at 4°C ...
-
No products found
because this supplier's products are not listed.
Shiaki A. Minami, et al.,
bioRxiv - Bioengineering 2021
Quote:
... 3-fold serial dilutions starting at 400 ng/well of rabbit anti-Spike primary antibody were used (PAb, SCV2-S-100, eEnzyme), and a 1:4000 goat anti-rabbit IgG ...
-
No products found
because this supplier's products are not listed.
Martin Göttlich, et al.,
bioRxiv - Neuroscience 2021
Quote:
Participants provided saliva samples in plastic vials (women: 4 ml Cryovials from Salimetrics, men ...
-
No products found
because this supplier's products are not listed.
Daniel D. Lewis, et al.,
bioRxiv - Biophysics 2022
Quote:
... pZ(PConst-TetX-GFP)-containing cells were diluted 1:100 in PBS and analyzed using a Novocyte Flow Cytometer (ACEA Biosciences).
-
No products found
because this supplier's products are not listed.
Haruna Fujioka, Manon Marchand, Adria C. LeBoeuf,
bioRxiv - Animal Behavior and Cognition 2023
Quote:
... We weighed 100 μL droplets using a micropipette and an electronic balance (Semi-Micro Analytical Balances, GH-202, A&D Company).
-
No products found
because this supplier's products are not listed.
Nika Heijmans, et al.,
bioRxiv - Developmental Biology 2024
Quote:
... Reactions were performed in triplicate in a 96×0.2 ml plate (BIOplastics, cat. #AB17500). Thermal cycling reactions included the following stages ...
-
No products found
because this supplier's products are not listed.
Tejram Sahu, et al.,
bioRxiv - Immunology 2020
Quote:
... Pellet containing merosomes and cells were further washed twice with cold PBS by centrifugation and resuspended in 100 μl of PBS from which 10 μl was used for counting using C-Chip disposable hemocytometer (INCYTO, SKC Inc, Covington, GA).
-
No products found
because this supplier's products are not listed.
Lisa C. Hiura, et al.,
bioRxiv - Neuroscience 2023
Quote:
... PBS + 10% normal donkey serum + 0.03% Triton-X-100) before being incubated in primary antibodies (48 h, Guinea Pig anti-VP 1:1000, Peninsula Laboratories, San Carlos, CA). Sections were rinsed in PBS (2 x 30m) ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...