Labshake search
Citations for Lamda Biotech :
1 - 2 of 2 citations for P N Nonylphenol Diethoxylate Ring 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and RT All-in-one master mix (Lamda Biotech G208-100). Endpoint PCR was done using EV primers (Forward – CGGCCCCTGAATGCGGCTAATCC ...
-
bioRxiv - Developmental Biology 2020Quote: Genomic DNA was extracted from frozen tissue using Tissue Direct PCR kit (Lamda Biotech D300-100), amplified using Taq Polymerase 2X PCR premix (Intact Genomics ...