-
No products found
because this supplier's products are not listed.
Bijal Patel, et al.,
bioRxiv - Physiology 2019
Quote:
... and single band and whole-lane (puromycin and total protein) band densitometry was conducted using NineAlliance UVITEC Software (UVITEC, Cambridge, UK).
-
No products found
because this supplier's products are not listed.
Kejia Zhang, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... FLAG-tagged proteins were purified by incubating whole cell lysates from the transfected cell lines with 20 μL of DYKDDDDK-Tag Monoclonal Antibody Magnetic Microbead (Syd Labs) for three hours at 4 °C ...
-
No products found
because this supplier's products are not listed.
Sara Meril, et al.,
bioRxiv - Cancer Biology 2023
Quote:
0.5 μg RNA was mixed with 4 μL 5X reaction buffer and 1 μL RTase (AzuraQuant cDNA synthesis kit, Azura Genomics cat: AZ1996). Reaction mix was incubated at 42°C for 30 min and denatured at 85°C for 10 min ...
-
No products found
because this supplier's products are not listed.
Christopher W. Bakerlee, et al.,
bioRxiv - Evolutionary Biology 2021
Quote:
... and 1 mg/mL 5-fluoroorotic acid monohydrate (5-FOA) (Matrix Scientific, CAS[220141-70-8]) in S/MSG D media (1.71 g/L Yeast Nitrogen Base Without Amino Acids and Ammonium Sulphate ...
-
No products found
because this supplier's products are not listed.
Shinya Ohara, et al.,
bioRxiv - Neuroscience 2021
Quote:
... Biocytin (5 mg/mL; Iris Biotech) was added to the internal solution in order to recover cell morphology ...
-
No products found
because this supplier's products are not listed.
Ana J. Chucair-Elliott, et al.,
bioRxiv - Neuroscience 2019
Quote:
... and positive fraction) and mouse methylation controls (#80-8063-MGHM-5 and #80-8064-MGUM-5; EpigenDX, Hopkinton, MA) were diluted in nuclease free elution buffer (Qiagen ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Misato Okamoto Miyakawa, Hitoshi Miyakawa,
bioRxiv - Evolutionary Biology 2022
Quote:
... Samples were prepared using a CyStain UV Precise P Kit (Sysmex Partec., GmbH.). Each body ...
-
No products found
because this supplier's products are not listed.
Klaudyna Borewicz, et al.,
bioRxiv - Microbiology 2024
Quote:
... PCR products were then purified with the HighPrep® PCR kit (MagBio Genomics, Gaithersburg, MD, USA) and concentrations of indexed cDNA were measured using the Qubit®dsDNA BR Assay Kit (Invitrogen ...
-
No products found
because this supplier's products are not listed.
Chongkai Zhai, et al.,
bioRxiv - Microbiology 2021
Quote:
... The D-dimer and FDPs concentrations of serum samples were determined by the double antibody sandwich method using mouse D-dimer and mouse FDPs ELISA kits (Sunlong Biotech, Hangzhou, Zhejiang, China) as described previously [44] ...
-
No products found
because this supplier's products are not listed.
Angus M Sidore, et al.,
bioRxiv - Synthetic Biology 2019
Quote:
... The individual wells were then washed >5 times using 2X Bind & Wash Buffer and a 384-Well Post Magnetic Plate (Permagen Labware, Peabody, MA). After washing ...
-
No products found
because this supplier's products are not listed.
Aliya Sharipova, et al.,
bioRxiv - Bioengineering 2022
Quote:
... the Fe with 1wt% VH precursor mixture was loaded into a custom-build consolidation die and high-pressure cold-sintered at 2.5 GPa (corresponding to 5 t for 5 mm diameter die) and RT using manual press (Carver, Wabash, IN, USA) to obtain the drug-loaded metal (Supplementary Materials ...
-
No products found
because this supplier's products are not listed.
Apsra Nasir, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 5% Fetal Bovine Serum (FBS) (Peak Serum, PS-FB2), ITS (Lonza ...
-
No products found
because this supplier's products are not listed.
Anne Rosbjerg, et al.,
bioRxiv - Immunology 2024
Quote:
... The plates were revealed using TMB One as the substrate (Kementec, 4380A). All dilutions and washing were performed in barbital/tween buffer (4 mM sodium barbital ...
-
No products found
because this supplier's products are not listed.
Melpomeni Platani, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Screened compounds were selected from the appropriate chemical library plates containing Cloud library (Enamine) and an in-house library of publicly available compounds ...
-
No products found
because this supplier's products are not listed.
Andrew R Harris, et al.,
bioRxiv - Biophysics 2020
Quote:
... and 5% biotinyl-amino-PEG (Rapp Polymere, #13 3000-25-20) which was incubated for a minimum of 4 hours at 50°C ...
-
No products found
because this supplier's products are not listed.
Daniel Lyngholm, et al.,
bioRxiv - Neuroscience 2019
Quote:
... 5-10nl of red or green fluorescent latex microspheres (Lumafluor, USA) (Katz et al. ...
-
No products found
because this supplier's products are not listed.
Honglin Jiang, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... A final concentration of 5 uM of SiRhoNox (FerroFarRed, GORYO Chemical) in a serum-free culture medium was added to the dish and incubate for 1 hour at 37°C ...
-
No products found
because this supplier's products are not listed.
Marissa L. Maciej-Hulme, et al.,
bioRxiv - Biochemistry 2020
Quote:
1 µl BODIPY-FL hydrazide (5 mg/mL, Setareh Biotech, Eugene, OR, USA) in DMSO was diluted in HPLC grade water before addition of organic solvent in a 1:9 (v/v ...
-
No products found
because this supplier's products are not listed.
Lingling Yin, et al.,
bioRxiv - Plant Biology 2023
Quote:
... and SL/KAR treatment using 5 μM rac-GR24 (Chiralix, Nijmegen, The Netherlands). For ChIP-seq experiments ...
-
No products found
because this supplier's products are not listed.
Natalie Ortiz Speer, et al.,
bioRxiv - Cell Biology 2023
Quote:
... Each plate was spotted with a neutral lipid reference standard mixture (Cat # 18-5C; Nu-Chek Prep). The standard was prepared in chloroform to a final concentration of 10 mg/ml and diluted to 1µg/µL before loading onto plate ...
-
No products found
because this supplier's products are not listed.
Carlos Theodore Huerta, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Generation 5 poly(amidoamine) (PAMAM) dendrimer was purchased from 21st Century Biochemicals (Marlborough, MA)
-
No products found
because this supplier's products are not listed.
Elizaveta O. Boldinova, et al.,
bioRxiv - Biochemistry 2023
Quote:
... Primer-18 was 5′-labeled with [γ-32P]-ATP by T4 polynucleotide kinase (SibEnzyme, Russia) and annealed to the corresponding unlabeled Template-55 at a molar ratio of 1:1.1 ...
-
No products found
because this supplier's products are not listed.
Manon Laporte, et al.,
bioRxiv - Microbiology 2019
Quote:
... the plates were stained overnight at 4°C with anti-NP antibody diluted in 1% BSA (for IAV: Hytest #3IN5 at 1/2000 and for IBV ...
-
No products found
because this supplier's products are not listed.
Andrey Zakharchenko, et al.,
bioRxiv - Biochemistry 2022
Quote:
Glutaraldehyde-fixed BP samples (n=5) were punched using 8 mm biopsy punches (Medline, Northfield, IL). Samples were rinsed with PBS and then incubated for 28 days in PBS with the following conditions either without inhibitors (Control ...
-
No products found
because this supplier's products are not listed.
Faisal Almansour, et al.,
bioRxiv - Cell Biology 2024
Quote:
... we used the same RP11 BAC probes tagged with Green 5-Fluorescein Conjugated dUTP (Empire Genomics).
-
Cat# ED209-5,
USD $479.0/kit
Ask
Nisha R. Dhanushkodi, et al.,
bioRxiv - Immunology 2021
Quote:
... Cells were then washed in RPMI medium and plated in specified cell numbers in ELISPOT membrane plates coated with either HSV-1 gD antigen (Virusys) (1ng/well ...
-
No products found
because this supplier's products are not listed.
Takenori Kanai, et al.,
bioRxiv - Cell Biology 2019
Quote:
Mouse calvaria osteoblasts originating from 80% confluent monolayers in the 24-well plates were incubated with primary antibodies (1 μg/ml): hamster monoclonal anti-mouse podoplanin (AngioBio), rabbit anti-mouse osteopontin (Abcam) ...
-
No products found
because this supplier's products are not listed.
Inyup Paik, et al.,
bioRxiv - Bioengineering 2021
Quote:
... A single colony was seed cultured overnight in 5 mL of superior broth (Athena Enzyme Systems, 0105). The next day ...
-
No products found
because this supplier's products are not listed.
Max G. Schubert, et al.,
bioRxiv - Microbiology 2023
Quote:
... then sparged into the cultures using a 5 X 210mm porosity B glass filter stick (Ace Glass).
-
No products found
because this supplier's products are not listed.
Christopher D. Go, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... Beads were then washed with 150 μl of HPLC-grade water (Caledon Laboratory Chemicals CAT# 7732-18-5), centrifuged at 400 RCF for 1 min to pellet beads ...
-
No products found
because this supplier's products are not listed.
Julia Ryvkin, et al.,
bioRxiv - Animal Behavior and Cognition 2022
Quote:
... 5 heads were transferred into soft tissue homogenizing CK 14 tubes containing 1.4 mm ceramic beads (Bertin corp.) prefilled with 600 ul of cold (−20 °C ...
-
No products found
because this supplier's products are not listed.
Ankita Gumaste, et al.,
bioRxiv - Neuroscience 2022
Quote:
Components for the artificial sniffing system used a mounted 5 mL glass syringe piston (Air-Tite, 7.140-33) coupled via a custom 3D-printed connector to a linear solenoid actuator (Soft Shift Part# 192907-023 ...
-
No products found
because this supplier's products are not listed.
Venecia Valdez, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 200 μM PMSF) before flowing over 5 mL CV of Strep-Tactin Superflow resin (Neuromics: 2-1206-025). The column was then washed with 10 CV of Strep binding buffer before being eluted with 1.5 CV of elution buffer (Strep binding buffer + 3.3 mM D-desthiobiotin) ...
-
No products found
because this supplier's products are not listed.
Helyaneh Ziaei Jam, et al.,
bioRxiv - Genomics 2023
Quote:
... and FMR1 we used available kits from Asuragen for genotyping (HTT ...
-
No products found
because this supplier's products are not listed.
Mahshid Gazorpak, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... 5% of the KH-103 in Captisol/DMSO was formulated in 20% Solutol (GLPBIO) in 0.9% sterile saline (Moltox) (w:v ...
-
No products found
because this supplier's products are not listed.
Antje Neeb, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... Lysate (600 μl) was incubated with 5 μg BAG-1L specific antibody rabbit monoclonal antibody (clone RM310; RevMAb Biosciences) at 4 °C for 16 hours to analyze the specificity of this antibody for its target ...
-
No products found
because this supplier's products are not listed.
Lei Wang, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and 50 μM Rho-associated kinase inhibitor (ATCC, ACS-3030) into each well of a 96-well Lipidure®-Coat Plate (Gel Company, LCV96). The medium was changed every other day for 6–7 days ...
-
No products found
because this supplier's products are not listed.
Hannah G. Leppert, et al.,
bioRxiv - Neuroscience 2023
Quote:
... were tested at 11 weeks of age as previously described over the course of 20 minutes using a force plate actimeter (BASi, West Lafayette, IN)53 ...
-
Peptide to Oxytocin
Cat# CCP1365,
1 mg USD $220.0, 5 mg USD $660.0, 10 mg USD $1100.0
Ask
Pierick Mouginot, et al.,
bioRxiv - Evolutionary Biology 2019
Quote:
... MDA concentrations were determined using the commercial kit MDA Microplate Assay Kit (Cat. no. CAK1011; Cohesion Bioscience; 532 and 600 nm). GSH levels were assessed with spectrophotometric method ...
-
No products found
because this supplier's products are not listed.
Miriam R. Fein, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... frozen tissue sections were incubated with 1x blocking buffer (5% goat serum, 2.5% BSA in PBS) and Fc receptor blocker (Innovex Biosciences). Sections were incubated with rabbit anti-CD3 polyclonal antibody (1:500 dilution ...
-
No products found
Yuxin Duan, et al.,
bioRxiv - Biophysics 2022
Quote:
... (Waltham, MA) N-hydroxyl succinimide-5 kDa PEG-biotin (NHS-PEG-biotin, HE041024-5K) was purchased from Biochempeg (Watertown, MA). 3-Aminopropyl triethoxysilane (APTES ...
-
No products found
because this supplier's products are not listed.
Pauline Bohne, et al.,
bioRxiv - Neuroscience 2023
Quote:
... connected to the ‘Brain Infusion Kit 3’ (#0004760, Durect). Pumps were prepared sterilely according to the manual ...
-
No products found
because this supplier's products are not listed.
Seung-Ho Lee, et al.,
bioRxiv - Microbiology 2021
Quote:
The viral genomic sequences were aligned and trimmed using the Clustal W tool in the Lasergene program version 5 (DNASTAR, USA), and multiple sequence alignment was performed with high accuracy and high throughput MUSCLE algorithms in MEGA 7.0 (53) ...
-
No products found
because this supplier's products are not listed.
Takanobu A. Katoh, et al.,
bioRxiv - Developmental Biology 2022
Quote:
... and with a single-mode fiber laser (wavelength of 1064Lnm; YLR-5-1064-LP-SF, IPG Photonics) and filter set (ZT1064rdc-sp, Chroma Technology, and SIX870, Asahi). A long-path filter was inserted before a halogen lamp (LV0630 ...
-
No products found
because this supplier's products are not listed.
Mohammed Fahad Albeshr, Abdulwahed Fahad Alrefaei,
bioRxiv - Epidemiology 2019
Quote:
... The swabs were then immediately inoculated individually into InPouchTM TV culture kits (BioMed Diagnostics) using the manufacturer’s guidance and instructions ...
-
No products found
because this supplier's products are not listed.
Matthew A. Lawlor, et al.,
bioRxiv - Genomics 2021
Quote:
... ribosomal RNAs were removed suing iTools rRNA depletion Kit from Galen Laboratory Supplies (dp-P020-000007) and Thermo Fisher MyOne Streptavidin C1 Dynabeads (#65001) ...
-
No products found
because this supplier's products are not listed.
Aarthi Subramani, et al.,
bioRxiv - Immunology 2020
Quote:
... Genomic DNA was then removed from the total RNA using a Message Clean kit (GenHunter, Nashville, TN) per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Susan Paton, et al.,
bioRxiv - Microbiology 2021
Quote:
... RT-PCR was performed using the VIASURE SARS-CoV-2 Real Time PCR Detection Kit (Viasure; CerTest Biotec, Zaragoza, Spain), following the methods provided ...