Labshake search
Citations for BestGene :
1 - 2 of 2 citations for Oxytocin ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
bioRxiv - Physiology 2023Quote: ... and correctly assembled clones were midi-prepped using Qiagen kits and integrated into the genome at the attP2 third-chromosome site by BestGene, Inc (Chino Hills ...