-
No products found
because this supplier's products are not listed.
Konstantina Nikolatou, et al.,
bioRxiv - Cancer Biology 2022
Quote:
PIP strips (Tebu-bio 117P-6001) were used as per the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
MD Fahlberg, et al.,
bioRxiv - Immunology 2020
Quote:
... and Kynurenine ELISA commercial kits (Rocky Mountain Diagnostics, Colorado Springs ...
-
Stripping buffer for stripping antibodies from chemiluminescent Western blots
Conserve valuable...
Cat# R-03722-D50,
500 ml, USD $115.00/ea
Ask
Sergio M. Pontejo, Philip M. Murphy,
bioRxiv - Immunology 2020
Quote:
... Strips were developed with WesternBright Sirius (Advansta, San Jose, CA) and imaged in an Omega Lum C imager (Gel Company ...
-
No products found
because this supplier's products are not listed.
Alan Dogan, Katherine Dabkowski, Horst von Recum,
bioRxiv - Bioengineering 2020
Quote:
... IL-10 ELISA Kit (Interleukin 10) was purchased from Antibodies-online.com (Limerick ...
-
No products found
because this supplier's products are not listed.
Rebecca Garnham, et al.,
bioRxiv - Cancer Biology 2023
Quote:
Human ST3Gal1 sandwich pre-validated ELISA kits were purchased from Cambridge Bioscience (RayBioTech, ELH-ST3GAL1). Samples and standards were assayed in duplicate according to the manufacturer’s protocol.
-
No products found
because this supplier's products are not listed.
Sarah E. Wolf, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... We conducted qPCR on 384-well plates (ABI Quantstudio 5, Foster City, CA). For each sample ...
-
No products found
because this supplier's products are not listed.
Jonathan R Baker, et al.,
bioRxiv - Cell Biology 2021
Quote:
... IL-36γ and IL-36RA were quantified using commercially available ELISA kits (AdipoGen life sciences, Epalinges, Switzerland); The lower limit of detection for these assays were 3.9 pg/ml (IL-36γ ...
-
No products found
because this supplier's products are not listed.
Yaping Meng, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... TSA Plus Cyanine 5 Kit (Akoya Biosciences, NEL745001KT) was used ...
-
No products found
because this supplier's products are not listed.
Wen Li, et al.,
bioRxiv - Physiology 2020
Quote:
Gastric antrum smooth muscle strips were attached to a Fort 10 isometric strain gauge (WPI, Sarasota, FL, USA), in parallel with the circular muscles ...
-
No products found
because this supplier's products are not listed.
Mohamed Reda Fazazi, et al.,
bioRxiv - Immunology 2023
Quote:
... Total anti-MOG IgG was quantified by using SensoLyte Anti-Mouse MOG(1–125) IgG Quantitative ELISA Kit (Anaspec).
-
No products found
because this supplier's products are not listed.
Heather Schiller, et al.,
bioRxiv - Microbiology 2023
Quote:
... Pop-out transformants were selected on agar plates containing 5-fluoroorotic acid (FOA) (Toronto Research Chemicals Inc.) at a final concentration of 50 μg mL-1 ...
-
No products found
because this supplier's products are not listed.
Alexander Shapson-Coe, et al.,
bioRxiv - Neuroscience 2021
Quote:
The tape holding the sections was cut into strips containing between nine and fifteen sections each and attached via strips of 25.4 mm double-sided carbon tape (Ted Pella, USA) onto either round or square silicon wafers (University Wafers ...
-
No products found
because this supplier's products are not listed.
Kristen W. Cohen, et al.,
bioRxiv - Immunology 2021
Quote:
Samples were single-cell sorted into 96-well PCR plates containing 5 µL of DNA Suspension Buffer (Teknova) with 1% BSA (Sigma-Aldrich ...
-
No products found
because this supplier's products are not listed.
EB Engler-Chiurazzi, et al.,
bioRxiv - Neuroscience 2022
Quote:
... and provided with environmental enrichment in the form of crinkled paper strips (Uline Shipping Supplies, Allentown, PA, USA) and corncob bedding (Envigo, Indianapolis, IN, USA), as well as access to chow pellets and water ad libitum throughout the entire study.
-
No products found
because this supplier's products are not listed.
Jonas L. Ravn, et al.,
bioRxiv - Microbiology 2022
Quote:
... with a starting OD600= 5 were pipetted onto Delft minimal medium agar plates (2 %) containing 0.4 % beechwood glucuronoxylan (Megazyme, Ireland) or wheat arabinoxylan (Megazyme ...
-
No products found
because this supplier's products are not listed.
Anne Berthold, Vett Lloyd,
bioRxiv - Molecular Biology 2022
Quote:
... starting material for the exposure experiments were HUVECs in passage 3 and HEK-293 cells in passage 5 seeded at a density of 4000 cells/cm2 into 6-well tissue culture plates (Celltreat, 229105) in antibiotic-containing media ...
-
No products found
because this supplier's products are not listed.
Manuel Gehl, et al.,
bioRxiv - Biochemistry 2023
Quote:
All crystallization experiments were carried out in an anaerobic chamber with a 95%/5% (N2/H2) atmosphere using the sitting drop vapor diffusion method and 96-well two-drop MRC crystallization plates (Molecular Dimensions). The plates were incubated for one week in the chamber before use ...
-
No products found
because this supplier's products are not listed.
Abhinav Parivesh, et al.,
bioRxiv - Cell Biology 2022
Quote:
... An xCELLigence E-Plate (ACEA BioSciences, VIEW 96 PET plate) was prepared with 50 μL of complete growth media in each well ...
-
No products found
because this supplier's products are not listed.
Elizabeth C. Stahl, et al.,
bioRxiv - Bioengineering 2023
Quote:
... The plate-reader based LAL assay was performed with the Endosafe Endochrome-K kit (Charles River, #R1708K), where a control standard endotoxin (CSE ...
-
No products found
because this supplier's products are not listed.
Denzil Furtado, et al.,
bioRxiv - Bioengineering 2022
Quote:
... or 5-methoxyuridine 5’-triphosphate (5moUTP, APExBIO), and cytidine 5’-triphosphate (CTP ...
-
No products found
because this supplier's products are not listed.
Amaris J Cardenas, et al.,
bioRxiv - Microbiology 2024
Quote:
... 0.06mM FAM alkyne 5-isomer (5-Carboxyfluorescein) (Lumiprobe), 2.4 mM L-ascorbic acid (VWR) ...
-
No products found
because this supplier's products are not listed.
Amanda M. Robinson, et al.,
bioRxiv - Immunology 2021
Quote:
... plate identifier sequence (RPI) and sequencing of 3’ UTRs ...
-
No products found
because this supplier's products are not listed.
Bader M. Jarai, Catherine A. Fromen,
bioRxiv - Bioengineering 2021
Quote:
... black walled 96-well plates (0.5-1.5×104 cells/well) and Cell Navigator™ Lysosome Staining Kit (AAT Bioquest) was used according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Tao Qiu, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... total RNA from the cells plated on 96 well plates were first extracted and purified using the RNAprep Pure Micro Kit (TIANGEN). Reverse transcription was performed with HiScript III cDNA Synthesis Kit (Vazyme) ...
-
No products found
because this supplier's products are not listed.
Flavia Chiuppesi, et al.,
bioRxiv - Immunology 2020
Quote:
... 5 ug of fragmented DNAs were converted to SMRTbell libraries using the SMRTbell Template Prep Kit 1.0 (PacBio). The libraries were size-selected (7-kb size cutoff ...
-
No products found
because this supplier's products are not listed.
Nikolai Wulff, et al.,
bioRxiv - Biochemistry 2019
Quote:
... Linearized DNA templates for RNA synthesis were obtained by PCR amplifying the coding sequences surrounded by Xenopus β-Globin 5’- and 3’- UTRs from pNB1u using forward primer (5’ – AATTAACCCTCACTAAAGGGTTGTAATACGACTCACTATAGGG – 3’) and reverse primer (5’ – TTTTTTTTTTTTTTTTTTTTTTTTTTTTTATACTCAAGCTAGCCTCGAG – 3’) PCR products were purified using E.Z.N.A Gel extraction kit (Omega Bio-tek) using the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Lucy Nevard, et al.,
bioRxiv - Biophysics 2021
Quote:
... to transduce the vibrations to the flower by fixing a metal rod to the vibrating plate of the speaker and attaching a pair of very fine tipped forceps (Fine Science Tools, Dumont #5 Biology Tip Inox Forceps) to the end of the rod ...
-
No products found
because this supplier's products are not listed.
Jyot D. Antani, et al.,
bioRxiv - Biophysics 2020
Quote:
... plates supplemented with Polymyxin-B (Alfa Aesar), Vancomycin (Sigma Aldrich) ...
-
No products found
because this supplier's products are not listed.
Lieke Koornneef, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... washed (5 × 5 min PBS-T) and scanned using Odyssey CLx imaging system (LI-COR).
-
No products found
because this supplier's products are not listed.
Vanessa Meier-Stephenson, et al.,
bioRxiv - Biophysics 2021
Quote:
... ELISA plates were prepared using HBsAg capture Ab (Fitzgerald Industries International ...
-
No products found
because this supplier's products are not listed.
Laween Meran, et al.,
bioRxiv - Bioengineering 2019
Quote:
... before transferring the scaffolds into perfusion plates (Amsbio #AMS.AVP-KIT-5) and connecting this to a bioreactor circuit ...
-
No products found
because this supplier's products are not listed.
Keiji Nakamura, et al.,
bioRxiv - Microbiology 2024
Quote:
... As the ELISA kit (RIDASCREEN Verotoxin; R-Biopharm AG) became unavailable in Japan during this study ...
-
No products found
because this supplier's products are not listed.
Michal Walczak, et al.,
bioRxiv - Synthetic Biology 2023
Quote:
... and sealed with DNase free tape (Grace Biolabs FlexWell Seal Strips) to prevent evaporation.
-
No products found
because this supplier's products are not listed.
Jia J. Li, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... The samples were then transferred to an 8-strip tube (EpiCypher 10-0009). Each sample was incubated with 0.5 µg primary or IgG control antibody (Supplemental Table 5 ...
-
No products found
because this supplier's products are not listed.
Tao Ni, et al.,
bioRxiv - Microbiology 2022
Quote:
... Seeding cells were maintained in liquid ATCC medium 290 or on ATCC 290 1.5% agar plates and inoculate in the Vishniac and Santer medium 40 in a 5-liter fermenter (BioFlo 115, New Brunswick Scientific, US) and were kept at constant pH 7.6 through supplement of 3 M KOH ...
-
No products found
because this supplier's products are not listed.
Yi-Pin Lin, et al.,
bioRxiv - Microbiology 2020
Quote:
... the ELISA kits to determine the levels of IFNγ and TNFα from house mouse (Mus muscuslus) (Tonbo Bioscience, San Diego, CA) were utilized to detect those cytokines in white-footed mice ...
-
No products found
because this supplier's products are not listed.
R Stehle,
bioRxiv - Biophysics 2020
Quote:
... Myofibrils were prepared at the day of the mechanical experiment by homogenizing the skinned strip at 0 °C for 4-6 s at maximum speed with a blender (T10 Ultra-Turrax, IKA, Stauffen, Germany) and filtering the homogenate through polypropylene meshes (22 µm pore opening).
-
To help researchers in the global fight against the coronavirus, abm has developed an RT-qPCR...
Cat# G628,
100 Rxns/kit, please contact supplier for pricing.
Ask
Keying Chen, et al.,
bioRxiv - Bioengineering 2024
Quote:
... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...
-
No products found
because this supplier's products are not listed.
Kiryl D. Piatkevich, et al.,
bioRxiv - Neuroscience 2019
Quote:
... Five voltage pulses (50 V, 50 ms duration, 1 Hz) were delivered using 5 mm round plate electrodes (ECM™ 830 electroporator, Harvard Apparatus), placing anode or cathode on the top of the skull to target cortex or hippocampus ...
-
BIONOVA X Bioprinting multi-well plates are the key to high throughput DLP printing. Available...
Cat# D16110025295,
12 well, USD $285.0
Ask
Patrick Carmody, et al.,
bioRxiv - Biochemistry 2023
Quote:
... in a humidified incubator containing 5% CO2 at 37°C on culture plates coated with PureCol purified bovine collagen (Advanced BioMatrix, Carlsbad, CA). CFBE41o-cells were transfected using Lipofectamine 3000 (ThermoFisher Scientific ...
-
No products found
because this supplier's products are not listed.
Maikke B. Ohlson, et al.,
bioRxiv - Microbiology 2022
Quote:
... 5-EU was labeled in permeabilized cells using the Click & Go Kit (Click Chemistry Tools #1263) with 2 μM Alexa Fluor 488 azide (Click Chemistry tools #1275 ...
-
No products found
because this supplier's products are not listed.
Preksha Gupta, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Rainbow Calibration particles (RCP-60-5-2, RCP-60-5-5) were obtained from Spherotech. FITC and PE stained beads were part of the three color BD CaliBRITE kit (BD Biosciences 340486) ...
-
No products found
because this supplier's products are not listed.
Bryce M. Connors, et al.,
bioRxiv - Systems Biology 2022
Quote:
... skirted PCR plates (Thomas Scientific) using an acoustic liquid handling robot (Echo LabCyte) ...
-
No products found
because this supplier's products are not listed.
Victoria G. Castiglioni, et al.,
bioRxiv - Evolutionary Biology 2024
Quote:
For sequencing the genome and 5’ ends of JUv2572_vlc RNA was extracted using the Viral RNA Isolation Kit (NZYTech) following manufacturer instructions.
-
No products found
because this supplier's products are not listed.
Costanza Borrelli, et al.,
bioRxiv - Cancer Biology 2023
Quote:
... 96 or 384 well plates were coated with rat tail collagen with the Collagen-I Cell Culture Surface Coating Kit (ScienCell Research Laboratories) following manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Adam Taheraly, et al.,
bioRxiv - Microbiology 2023
Quote:
... Triphosphate in 5’ were removed using a RNA 5’ polyphosphatase (Euromedex Lucigen) and RNA were purified using 3 volume of absolute isopropanol and 1.8 volume of Agencourt RNAClean XP beads (Beckman) ...
-
No products found
because this supplier's products are not listed.
Niccolò Paolo Pampaloni, et al.,
bioRxiv - Neuroscience 2020
Quote:
... QX-314 (5 mM, HelloBio) was added to the pipette solution.
-
No products found
because this supplier's products are not listed.
Sarah Hofmann, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 5 ug/ml insulin (PromoCell), 0.5 ug/ml Hydrocortisone ...
-
No products found
because this supplier's products are not listed.
Christopher J. Roome, Bernd Kuhn,
bioRxiv - Neuroscience 2020
Quote:
... head-plate stage and micromanipulator tower (Sutter Instruments), all mounted on a horizontally rotating stage (8MR190-90-4247 ...
-
No products found
because this supplier's products are not listed.
Shanlin Rao, et al.,
bioRxiv - Cell Biology 2023
Quote:
... and 5% DOPS (Avanti Polar Lipids) was dried under a nitrogen stream and put under vacuum overnight ...