Labshake search
Citations for Applied Biological Materials :
1 - 50 of 106 citations for Oxytocin ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... Subsequently these layers were patterned into 1 cm x 10 or 20 µm strips via photolithography (ABM-USA, INC., Jan Jose, CA, USA) and a wet chemical etching of titanium and copper with copper etchant (Millipore Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were maintained in 100 units/mL penicillin/streptomycin under 5% CO2 at 37°C and routinely tested for mycoplasma contamination using the PCR Mycoplasma Detection Kit (ABM). Cells were cultured in the following media ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cDNA was synthesized from the isolated RNA by reverse transcription using RevertAid™ first strand cDNA synthesis kit (5× All-In-One RT MasterMix, ABM) according to the manufacturer’s instructions in a RNase-free environment ...
-
bioRxiv - Cancer Biology 2021Quote: ... The mRNA and miRNA reverse transcription were performed within a 5×All-In-One RT MasterMix kit (Applied Biological Materials, BC, Canada) and TaqMan microRNA Reverse Transcription Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: cDNA synthesis was carried out with isolated total RNA using 5 X All-In-One RT MasterMix kit (Applied Biological Materials, G490) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG7 shRNA-GFP (5’-CAGTGGATCTAAATCTCAAACTGAT-3’) and scrambled control shRNA-GFP (5’-GGGTGAACTCACGTCAGAA −3’) lentiviral plasmids were purchased from Applied Biological Materials Inc ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was carried out using ‘5× All-in-one RT Mastermix’ (#g486; ABM), following the manufacturer instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by preparation of cDNA using 5× All-In- One RT MasterMix (Applied Biological Materials Inc.) as per the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... before reverse transcription to cDNA using a 5×All-In-One RT MasterMix (Applied Biological Materials Inc.). PhnsLTP1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cDNA was synthesized from total RNA by using 5×All-In-One RT MasterMix (ABM, China) following the standard protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... and titered using lentivirus qPCR titer kit (ABM). 1963B and BT20 cells were transduced with the virus at an MOI of 10 following puromycin selection (2 ug/ml ...
-
bioRxiv - Immunology 2023Quote: ... or ABM All-in-one RT kit (ABM) was used to synthesize cDNA according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: The recombinant adenovirus 5 expressing human ACE2 (Ad5-hACE2) and control adenovirus (Ad5-Ctrl) were purchased from ABM (Vancouver, Canada) or generated in the laboratory ...
-
bioRxiv - Cancer Biology 2022Quote: ... All cell lines were cultured in DMEM supplemented with 10% FBS and 100 units/mL penicillin/streptomycin under 5% CO2 at 37C and were routinely tested for mycoplasma contamination by ABM’s PCR Mycoplasma detection kit ...
-
bioRxiv - Neuroscience 2022Quote: ... and cDNA generated (OneScript Hot cDNA Synthesis Kit, ABM) based on manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the PCR mycoplasma detection kit (ABM, Cat. G238).
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the PCR mycoplasma detection kit (ABM, Cat No. G238). All experiments were carried out in mycoplasma-free cultures ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with OneScript® Plus cDNA Synthesis Kit (ABM), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: E15 DRG neurons in microfluidic devices were transduced on DIV1 with 5-10µl AAV9-axonal-GCaMP6s- P2A-mRuby3 (Broussard et al., 2018) (AAV9 was generated by Applied Biological Materials, Canada) alone or together with 25µl lentivirus expressing shRNA targeting tGFP ...
-
bioRxiv - Genomics 2021Quote: ... and PCR amplified using with a 5′-primer for mmu-miR-682 (CTGCAGTCACAGTGAAGTCTG) and the universal 3′ miRNA primer (Applied Biological Materials). Relative Ct values were calculated based on start-point samples and compared to the mid-(only for IL-KO ...
-
bioRxiv - Microbiology 2020Quote: The OneScript Reverse Transcriptase cDNA Synthesis kit by Applied Biological Materials Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral particles were tittered via qPCR (ABM qPCR Lentivirus Titration Kit) before storage at −80°C.
-
bioRxiv - Genomics 2023Quote: ... Viral titers were assessed with a qPCR Lentivirus Titration Kit (ABM) and functional titers were assessed by transducing iPSC-derived NPCs with serial dilutions of virus and quantifying BFP fluorescence intensity and RNase H1 protein levels by Western Blot.
-
bioRxiv - Cancer Biology 2022Quote: ... and confirmed mycoplasma free using a PCR detection kit (ABM G238). Recombination of the LSL-Nras allele was verified by PCR using the following primers ...
-
bioRxiv - Molecular Biology 2020Quote: PAEC were transduced with adenoviral constructs encoding a constitutive active mutant of dual specificity mitogen-activated protein kinase 5 (caMEK5) (#000101A, Applied Biological Materials Inc); Flag-tagged KLF4 (#VH829440 ...
-
bioRxiv - Neuroscience 2020Quote: ... or qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., Richmond, BC, Canada). Viral titers were 1.425 x 109 GC/mL for lacZ sgRNA control ...
-
bioRxiv - Cancer Biology 2021Quote: ... High Titer cell immortalization kit (Applied Biological Materials, cat. no. LV613; www.abmgood.com), per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... Lentiviral shRNA particles were titered using the qPCR Lentiviral Titration Kit (ABM). shRNA particles were transduced into 12Z cells at a 100-fold multiplicity of infection ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR were run using a Taq DNA polymerases Kit (ABM, Richmond, B.C) and a thermal cycler (Bio-Rad ...
-
bioRxiv - Genomics 2021Quote: miRNA All-In-One cDNA Synthesis Kit (Applied Biological Materials, Richmond, BC, Canada) was used to convert RNA to generate ...
-
bioRxiv - Cell Biology 2022Quote: ... Mycoplasma testing was conducted monthly using a mycoplasma PCR detection kit (ABM, G238). Human and mouse cell lines were authenticated by STR profiling (Almeida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... Genomes were quantified using a qPCR Lentivirus Titer Kit (Applied Biological Materials, LC900) as per the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... carried out with the OneScript® Plus cDNA Synthesis Kit (ABM, Richmond, Canada). For amplification of the full HhTAR1 open reading frame (ORF) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... and tittered by qPCR Lentivirus Titration Kit (Applied Biological Materials Inc., LV900-S). bEnd.3 cells were plated in 6-well plates and allowed to adhere overnight ...
-
bioRxiv - Genomics 2022Quote: ... The cells were tested for Mycoplasma contamination with the PCR detection kit (ABM) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Lentiviral titers were determined using the qPCR Lentivirus Titration Kit (Applied Biological Materials), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Lentivirus was titered using the qPCR Lentivirus Titration Kit (Applied Biological Materials LV900).
-
bioRxiv - Cancer Biology 2021Quote: ... Cultures were regularly checked for mycoplasma contamination utilizing a PCR detection kit (G238, ABM) or Hoechst staining ...
-
bioRxiv - Cell Biology 2022Quote: ... lentiviral particles were titrated using the qPCR lentivirus titration kit (Applied Biological Materials Inc.) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Cancer Biology 2023Quote: ... cultures were screened for various Mycoplasma strains using the PCR Mycoplasma detection kit (ABM) and confirmed negative before being used for experimental assays ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-time PCR was performed using the SYBR Green PCR kit(Applied Biological Materials, ABM) and a Rotor-Gene-Q instrument (QIAGEN) ...
-
bioRxiv - Neuroscience 2021Quote: ... Viral titer was determined with an ABM qPCR Lentivirus Titration Kit (ABM, Vancouver, B.C., Canada). Titers were 106-107 infectious particles/mL.
-
bioRxiv - Cancer Biology 2020Quote: ... and the absence of mycoplasma was confirmed using Mycoplasma PCR detection kit (Applied Biological Materials).
-
bioRxiv - Cell Biology 2021Quote: ... Lentivirus titers were measured by using the qPCR Lentivirus Titer Kit (Applied Biological Materials, China).
-
bioRxiv - Neuroscience 2022Quote: ... The titer was determined using the qPCR Adeno-Associated Virus Titration kit (Applied Biological Materials) and the purity was verified by SDS-PAGE and total protein staining using instant blue reagent (Expedeon) ...
-
bioRxiv - Cell Biology 2022Quote: ... The lentivirus was quantified with the qPCR lentivirus titration kit (Applied Biological Materials, catalog #: LV900), and stored at −80°C.