-
No products found
because this supplier's products are not listed.
Christopher J. Fitzpatrick, et al.,
bioRxiv - Animal Behavior and Cognition 2019
Quote:
... and fibroblast growth factor 2 (FGF2; #45103P; QED Bioscience, Inc.; San Diego, CA) were used ...
-
No products found
because this supplier's products are not listed.
Eva Jarc Jovičić, et al.,
bioRxiv - Cell Biology 2022
Quote:
... 500 nM BHT and IS (8 pmol 18:3/18:3/18:3 triacylglycerol, 14:0/14:0 phosphatidylcholine, Larodan, Solna ...
-
No products found
because this supplier's products are not listed.
Tomás Urzúa Lehuedé, et al.,
bioRxiv - Plant Biology 2024
Quote:
... 3% Gelzan (PhytoTechnology laboratories, USA) plates and stored at 4°C for 3 days in the dark ...
-
No products found
because this supplier's products are not listed.
Preetha Shridas, et al.,
bioRxiv - Pathology 2023
Quote:
Plasma SAA (SAA1.1 and SAA2.1 isoforms) concentrations were determined using a mouse SAA ELISA kit (cat no TP 802M, Tridelta Development Ltd). Plasma cholesterol concentrations were measured using enzymatic kits (Wako Chemicals).
-
No products found
because this supplier's products are not listed.
Bruno Raposo, et al.,
bioRxiv - Immunology 2022
Quote:
... All clones were initially identified as ACPAs by screening using antigen microarray binding to citrullinated peptides and CCP2 by CCPlus ELISA (Svar Life Science) at 5 μg/ml ...
-
No products found
because this supplier's products are not listed.
Shima Shahbaz, et al.,
bioRxiv - Immunology 2020
Quote:
... The SARS-CoV-19 spike receptor binding domain protein was purchased from VIROGEN (Cat#00224-V), conjugated with dye using Fluorescent protein labeling kit according to the manufacturing protocol (Thermo Fisher Scientific ...
-
No products found
because this supplier's products are not listed.
Anne Van Arsdale, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... The FISH probe was labeled by nick translation using DY-415-aadUTP (Dyomics, Jena, GE, USA) as previously described (86 ...
-
No products found
because this supplier's products are not listed.
Naushin L. Hindul, et al.,
bioRxiv - Cell Biology 2023
Quote:
... The starved cells were growth-factor stimulated with fresh DMEM media containing 100ng/ml epidermal growth factor (EGF Human #A63411-500 (Antibodies.com)) ...
-
No products found
because this supplier's products are not listed.
Nadja I. Lorenz, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... 20 ng/ml epidermal growth factor (EGF) and 20 ng/ml human recombinant basic fibroblast growth factor (bFGF) (ReliaTech, Wolfenbüttel, Germany).
-
No products found
because this supplier's products are not listed.
Theodore L. Roth, et al.,
bioRxiv - Immunology 2019
Quote:
... a 1G4 TCR (NY-ESO-1 specific) binding dextramer (Immudex) was bound to cells at 1:50 dilution in 50 uL (500,000 cells total ...
-
No products found
because this supplier's products are not listed.
Marlou L. Dirks, et al.,
bioRxiv - Physiology 2023
Quote:
... Arterialized serum samples were used to determine insulin concentrations (Human insulin ELISA kit, DX-EIA-2935; Oxford Biosystems Ltd, Milton Park, UK). Serum NEFA concentrations were measured spectrophotometrically in arterialized venous and deep-venous serum samples (FA115 kit ...
-
No products found
because this supplier's products are not listed.
Daisuke Shimura, et al.,
bioRxiv - Cell Biology 2021
Quote:
... using Mouse Mitochondrial DNA Copy Number Assay kit (Detroit R&D, Detroit, MI) for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio ...
-
No products found
because this supplier's products are not listed.
Kevin G. Burt, et al.,
bioRxiv - Bioengineering 2023
Quote:
... Tissue sections were blocked (45 min) for non-specific binding using background buster (Innovex Biosciences). Sections were then incubated overnight at 4°C with primary antibodies ...
-
No products found
because this supplier's products are not listed.
Lisa Pomeranz, et al.,
bioRxiv - Bioengineering 2023
Quote:
ELISA plates were coated with 1µg/mL human spleen ferritin (Lee Biosolutions, MO) in PBS overnight at 4°C ...
-
No products found
because this supplier's products are not listed.
Kari Martyniak, et al.,
bioRxiv - Bioengineering 2022
Quote:
... and 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC, 5.832g, Oakwood Chemical) were added to the solution under stirring to activate 30 % of the carboxylic acids of the oxidized alginate ...
-
No products found
because this supplier's products are not listed.
Alex M. Jaeger, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... 3 µM CHIR99021 (AbMole), 1 µM PD0325901(AbMole)] ...
-
No products found
because this supplier's products are not listed.
Ruisheng Lin, et al.,
bioRxiv - Biophysics 2019
Quote:
... Non-specific binding of imager strands to the coverslip surface was prevented with PLL-g-PEG (SuSoS). PLL-g-PEG was dissolved in PBS (pH 7.4 ...
-
No products found
because this supplier's products are not listed.
Courtney L. Finch, et al.,
bioRxiv - Microbiology 2020
Quote:
... and blocked with ELISA diluent (5% nonfat milk [LabScientific, Danvers, MA, USA] in PBS-T) for 1 h at 37°C ...
-
No products found
because this supplier's products are not listed.
Eric L. Van Nostrand, et al.,
bioRxiv - Genomics 2020
Quote:
... 3% Trichloroacetic acid (Glen Research) as the deblocking solution ...
-
No products found
because this supplier's products are not listed.
Matiss Maleckis, et al.,
bioRxiv - Bioengineering 2024
Quote:
... and 10 μM Hexakis (2, 2, 3, 3-tetrafluoropropoxy) phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses ...
-
No products found
because this supplier's products are not listed.
Yuma Kato, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and 3 μM CHIR99021 (Focus Biomolecules, USA). On day 2 ...
-
No products found
because this supplier's products are not listed.
Marc-Joseph Antonini, et al.,
bioRxiv - Neuroscience 2021
Quote:
... and Ag/AgCl electrode (BASi, 3 M NaCl) were used as the counter and reference electrodes ...
-
No products found
because this supplier's products are not listed.
Nadya Povysheva, Huiyuan Zheng, Linda Rinaman,
bioRxiv - Neuroscience 2021
Quote:
... adult male Sprague-Dawley rats (n=3; 225-250 g BW) were anesthetized by isoflurane inhalation (1-3% in oxygen; Halocarbon Laboratories) and placed into a stereotaxic device in the flat skull position ...
-
No products found
because this supplier's products are not listed.
Takiyah A. Ball, et al.,
bioRxiv - Microbiology 2019
Quote:
... Drag swabs (3” × 3” sterile gauze pads) in sterile skim milk was the preferred collection tool (Hardy Diagnostics, Inc., Santa Maria, CA). A sampling schematic was pre-drawn to ensure maximum sampling of the house floor environment ...
-
No products found
because this supplier's products are not listed.
Jaqueline S. Generoso, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Rabbit polyclonal anti-capsule serotype 3 antiserum (SSI Diagnostica) followed by Alexa Fluor 594 goat anti-rabbit (Thermo Fisher Scientific) ...
-
No products found
because this supplier's products are not listed.
Jin-Ran Chen, et al.,
bioRxiv - Developmental Biology 2021
Quote:
... Serum bone resorption marker C-terminal telopeptides of type I collagen (CTX-1) was measured by Rat-LapsTM ELISA from Nordic Biosciences Diagnostic (Herlev ...
-
No products found
because this supplier's products are not listed.
Daniela Fraccarollo, et al.,
bioRxiv - Immunology 2021
Quote:
... Serum samples were screened for CMV-specific IgG antibodies with the CMV-IgG-ELISA PKS Medac enzyme immunoassay (115-Q-PKS; Medac Diagnostika), using a cut-off value of >0.55 AU/mL for defining seropositivity according to manufacturer’s guidelines ...
-
No products found
because this supplier's products are not listed.
Jason Yun, et al.,
bioRxiv - Bioengineering 2023
Quote:
... indole-3-acetic acid from Neta Scientific (Hainesport, NJ, USA), asunaprevir was purchased from AdooQ Biosciences (Irvine ...
-
No products found
because this supplier's products are not listed.
Raeann Goering, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... with protein ladder (Gel Company FPL-008). Gels were imaged with a Sapphire molecular imager (Azure Biosystems ...
-
No products found
because this supplier's products are not listed.
Julio García-Villalba, et al.,
bioRxiv - Immunology 2022
Quote:
... GSDMD and P2X7 were also tested by ELISA (Cusabio for ASC and P2X7, Aviva System Biology for GSDMD and Arigo Biolaboratories for HMGB1). Results were read in a Synergy Mx (BioTek ...
-
No products found
because this supplier's products are not listed.
Madalee G. Wulf, et al.,
bioRxiv - Molecular Biology 2019
Quote:
... The 5’-[m7Gppp]GUAGAACUUCGUCGAGUACGCUCAA[FAM]-3 was purchased from Bio-Synthesis, Inc ...
-
No products found
because this supplier's products are not listed.
Sara C. Di Rienzi, et al.,
bioRxiv - Microbiology 2022
Quote:
... 3-inch needle (N163D, Air-Tite Vet Premium Hypodermic Needles, USA) positioned at the level within the glass reactor such that the media level was at 15 mls ...
-
No products found
because this supplier's products are not listed.
Suranjana Pal, et al.,
bioRxiv - Neuroscience 2020
Quote:
... Mouse anti-RFP (1:200; Allele Biotech, catalog #ABP-MAB-RT008 ...
-
No products found
because this supplier's products are not listed.
Sandro Roier, et al.,
bioRxiv - Immunology 2023
Quote:
... The protein vaccines were alum-adjuvanted by adsorption of the recombinant fusion proteins to aluminum hydroxide (Alhydrogel®; Croda, Frederikssund, Denmark) as previously described22 ...
-
No products found
because this supplier's products are not listed.
Didier Hodzic, et al.,
bioRxiv - Cell Biology 2022
Quote:
... Multi-Trol mouse serum controls (Drew Scientific, Inc.) were used for calibration of the Hemavet HV950 ...
-
No products found
because this supplier's products are not listed.
Kristina Astleford-Hopper, et al.,
bioRxiv - Cell Biology 2022
Quote:
3-month-old femora were isolated and fixed in Z-fix (Anatech LTD) and placed in 10% EDTA (pH 7.4 ...
-
Eukaryotic translation initiation factor 4 gamma 1 (719-727) is a 9-aa peptide. EIF-4-gamma 1 is...
Cat# BAT-009440,
Inquire
Ask
Sean P Harrison, et al.,
bioRxiv - Cell Biology 2020
Quote:
... depending on the cell line and 3 or 4 μM CHIR99021 (BOC Sciences). Optimal conditions need to be established for each line based on our previously established protocol 4 ...
-
No products found
because this supplier's products are not listed.
Francisco J. Calero-Cuenca, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-Myc 1:200 (Alfagene/Life Technologies #13-2500). The secondary antibodies (1:600 dilution ...
-
No products found
because this supplier's products are not listed.
Beatriz Gil, et al.,
bioRxiv - Neuroscience 2022
Quote:
... Recombinant alpha- synuclein protein was a gift from rPeptide (GA, USA).
-
No products found
because this supplier's products are not listed.
Kyungho Kim, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-KLHL12 (#30058, 1:1000, ProMab Biotechnology, Richmond, CA,USA), rabbit anti-KLHL40 (#HPA024463 ...
-
No products found
because this supplier's products are not listed.
MaryAnn Martin, Irene L.G. Newton,
bioRxiv - Microbiology 2023
Quote:
Proteins were separated on 4-20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours ...
-
No products found
because this supplier's products are not listed.
Chao Li, et al.,
bioRxiv - Biophysics 2024
Quote:
... Plasma Surface Technology) at 100 W for 3 min and then moved to a vacuum desiccator (Bel-Art F420220000 ...
-
No products found
because this supplier's products are not listed.
Gary Reynolds, et al.,
bioRxiv - Immunology 2020
Quote:
... then resuspended in 200 μl of flow buffer per 106 cells with 3 μM DAPI (Sysmex Partec, 05-5005). Cells were then run through a Fortessa X20 for analysis ...
-
siRNA to inhibit EIF4EBP3 expression using RNA interference
Cat# CRN0917,
15 nmol USD $340.0, 30 nmol USD $510.0
Ask
Yingjuan Liu, et al.,
bioRxiv - Genetics 2020
Quote:
... Secondary antibodies used for IF were goat-anti-mouse H&L FITC (Cohesion Biosciences) or goat-anti-rabbit H&L FITC (Cohesion Biosciences) ...
-
No products found
because this supplier's products are not listed.
David S. Yang, et al.,
bioRxiv - Biophysics 2020
Quote:
... Protein and incubation buffer were filtered with 0.22 μm Polyethersulfone (PES) (CELLTREAT Scientific Products, 229746) syringe filters ...
-
No products found
because this supplier's products are not listed.
Hao Wu, et al.,
bioRxiv - Cell Biology 2019
Quote:
PWS-IC methylation was analyzed by pyrosequencing of the intron 3 in human SNRPN gene (EpigenDX, Assay ID: ADS265-RS1), an established assay to determine the methylation status of PWS-IC (White et al. ...
-
No products found
because this supplier's products are not listed.
Emily Z. Guo, et al.,
bioRxiv - Microbiology 2024
Quote:
... 3 µl of the sample was deposited onto glow-discharged Quantifoil R2/1 300 Mesh Gold Holey Carbon Grids (SPI supplies) and plunged into liquid ethane using a Vitrobot Mark IV (Thermo Fisher ...
-
No products found
because this supplier's products are not listed.
Jana Täumer, et al.,
bioRxiv - Microbiology 2021
Quote:
... where fragmentation time was adjusted to 3 min and a size selection step with HighPrep™ PCR beads (MagBio Genomics Inc., Gaithersburg, USA) was introduced (desired insert size 250 bp) ...
-
No products found
because this supplier's products are not listed.
Gustavo W. Fernandes, et al.,
bioRxiv - Physiology 2020
Quote:
In vivo transfections were performed with a liver transfection kit (Altogen Biosystems), as previously described (Fernandes et al. ...
-
No products found
because this supplier's products are not listed.
Jiyeon Choi, et al.,
bioRxiv - Genomics 2019
Quote:
... following the instructions of the Micellula DNA Emulsion & Purification Kit (EURx/CHIMERx). Amplified oligos were quantified using KAPA qPCR assay and verified by DNA sequencing on Ion PGM ...