-
No products found
because this supplier's products are not listed.
Deborah L. Gater, et al.,
bioRxiv - Biophysics 2022
Quote:
... Vitamin D binding protein (DBP) was purchased from Athens Research and Vitamin D Binding protein (VDR ...
-
No products found
because this supplier's products are not listed.
Roya Yousefi, et al.,
bioRxiv - Biochemistry 2020
Quote:
... Cytosolic translation was stopped using harringtonine (200μM, Carbosynth) for 20 minutes ...
-
No products found
because this supplier's products are not listed.
Samia Bouamama, Amina Bouamama,
bioRxiv - Pharmacology and Toxicology 2022
Quote:
An enzyme-linked immunosorbent assay (ELISA) kit was used to determine the levels of IL-2 cytokine released in PBMC free supernatants (Abfrontier, Multiplex Human Cytokine ELISA Kit).
-
Cat# AK290-2,
USD $495.0/kit
Ask
Remigiusz A. Serwa, et al.,
bioRxiv - Microbiology 2019
Quote:
... monoclonal mouse anti-VP5 capsid protein(1:2500, Virusys) and rabbit anti-gE/I anti-sgE/I envelop protein (1:1000 ...
-
No products found
because this supplier's products are not listed.
Armand O. Brown, et al.,
bioRxiv - Microbiology 2020
Quote:
... inflammatory chemokines and cytokines were additionally analyzed using a Mouse Cytokine ELISA Plate Array III Colorimetric Assay (Signosis). The data represent an average of at least 3 independent experiments for each strain and were analyzed using Student’s two-tailed t-test.
-
No products found
because this supplier's products are not listed.
Amanda P. Waller, et al.,
bioRxiv - Pathology 2020
Quote:
... ELISA and immunoblot antibodies were validated using species-specific positive (purified species-specific protein; Haematologic Technologies, Inc, Essex Juntion, VT) and non-specific protein negative controls ...
-
No products found
because this supplier's products are not listed.
Jip Zonderland, Silvia Rezzola, Lorenzo Moroni,
bioRxiv - Bioengineering 2019
Quote:
... or basic fibroblast growth factor (bFGF) (Neuromics), ethanol sterilized ESP scaffolds were incubated in 0,5M NaOH for 30min at room temperature to open the ester bond of the 300PEOT55PBT45 polymer ...
-
No products found
because this supplier's products are not listed.
Amanda M. Robinson, et al.,
bioRxiv - Immunology 2021
Quote:
... 100uL of beads were used per library with pure bead binding buffer for the remaining volume (Bead Binding Buffer, 2.5M NaCl, 20% vol/vol PEG, Teknova #P4146). The beads and library were mixed and allowed to bind for 5 minutes at room temperature before using a magnetic stand to pellet the beads for removal of supernatant ...
-
No products found
because this supplier's products are not listed.
Nereus W. Gunther IV, et al.,
bioRxiv - Microbiology 2022
Quote:
... ProteaPrep cell lysis buffer plus 100 μLs of a protease inhibitor cocktail was used to suspend each of the cell pellets before placing them in 2 mL micro-centrifuge tubes preloaded with low protein binding 100 micron zirconium beads (OPS Diagnostics, LLC, Lebanon, NJ). Next the cells were disrupted by agitation of the beads using a BeadBeater system (BioSpec Products ...
-
No products found
because this supplier's products are not listed.
Evan Lester, et al.,
bioRxiv - Molecular Biology 2021
Quote:
... non-specific binding sites were blocked using Super Block (Scytek), supplemented with Avidin (Vector Labs) ...
-
No products found
because this supplier's products are not listed.
Christopher M. Yellman,
bioRxiv - Genetics 2021
Quote:
... The native Nop1 protein was stained with the MCA-28F2 mouse monoclonal antibody (EnCor Biotechnology), followed by anti-mouse CY3 (Jackson ImmunoResearch)
-
No products found
because this supplier's products are not listed.
Frederique Ruf-Zamojski, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 1 μg of a gel-purified mutagenic primer targeting mouse rs11031006 (5’-CTGGAATTTAATATTGCTCTGCCCTGTGATATTTATTTCAAGGTTAGTAGAAATGTAGCTACCTCCTGTAATGACAAATGA-3’) using PolyJet In Vitro DNA Transfection Reagent (SignaGen Laboratories). At 18 hours post transfection ...
-
No products found
because this supplier's products are not listed.
Donggi Paik, et al.,
bioRxiv - Immunology 2021
Quote:
... 3-oxoLCA (Steraloids (C1750-000 ...
-
No products found
because this supplier's products are not listed.
José Antonio Valer, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... Binding was detected with HRP-conjugated secondary antibodies and visualized by Brightfield ECL (Thomas Scientific) on the ChemiDoc (BioRad).
-
No products found
because this supplier's products are not listed.
Shun-saku Takahashi, et al.,
bioRxiv - Cell Biology 2019
Quote:
... followed by N-Histofine® simple stain mouse MAX PO kit (NICHIREI BIOSCIENCES, Japan) using 3,3’-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Domenico Viola, et al.,
bioRxiv - Cancer Biology 2019
Quote:
... with 100 μl of the D-Luciferin solution at a final dose of 3 mg/20 g mouse body weight (Biosynth, Cat. No. L-82220) and then gas-anaesthetized with isoflurane (Faulding Pharmaceuticals) ...
-
No products found
because this supplier's products are not listed.
Krishna Patel, et al.,
bioRxiv - Molecular Biology 2023
Quote:
Conversion of dsDNAs to ssDNAs was determined by their binding to SSB (MCLAB - Molecular Cloning Laboratories, CA). DNA samples were mixed with 1 ...
-
No products found
because this supplier's products are not listed.
NV DiBenedetto, et al.,
bioRxiv - Microbiology 2023
Quote:
... The same procedure is used for the Toxin B ELISA but N4A8 monoclonal antibodies (BBI solution) diluted at 4ng/ml in PBS was used for the capture antibodies and the T4G1 monoclonal antibodies previously coupled to biotin were used as detection antibodies (BBI solution ...
-
No products found
because this supplier's products are not listed.
Séamas Weech, Travis Wall, Michael Barnett-Cowan,
bioRxiv - Neuroscience 2019
Quote:
... participants were exposed to the GVS stimulus according to their randomly assigned group (GVS or sham; between-subjects factor). The GVS group received a bilateral noisy low-frequency (LF ...
-
No products found
because this supplier's products are not listed.
Zhexin Wang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... and 3 times at 10,000 rpm for 5 s (IKA TC10 basic ULTRA-TURRAX® homogenizer with S10N-5G dispersing element ...
-
No products found
because this supplier's products are not listed.
Felix Jonas, Gilad Yaakov, Naama Barkai,
bioRxiv - Genomics 2022
Quote:
... Cells were processed for 3 cycles in a Bullet Blender 24 (Next Advance) at level 8 for 1 min ...
-
No products found
because this supplier's products are not listed.
Taiyi Kuo, Domenico Accili,
bioRxiv - Physiology 2020
Quote:
... and NEFA kit (Wako Diagnostics).
-
No products found
because this supplier's products are not listed.
Ankita B. Jaykumar, et al.,
bioRxiv - Cancer Biology 2021
Quote:
... and mycoplasma-free (e-Myco Kit, Boca Scientific or Universal Mycoplasma Detection Kit 30-1012K ...
-
No products found
because this supplier's products are not listed.
Mizuho Nosaka, et al.,
bioRxiv - Molecular Biology 2023
Quote:
... tPA (Mouse tPA ELISA Kit, PA92, Oxford Biomedical Research, Rochester Hills, MI), uPA (Active mouse uPA Functional Assay Kit ...
-
No products found
because this supplier's products are not listed.
Carina C D Joe, et al.,
bioRxiv - Bioengineering 2021
Quote:
Residual host-cell protein (HCP) was quantified using the HEK293 HCP ELISA kit (Cygnus Technologies) according to the manufacturer’s instructions ...
-
No products found
because this supplier's products are not listed.
Yi Xiao Jiang, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... or Anti TAR DNA-Binding Protein 43 phospho-Ser409/410 mAb (Cosmo Bio USA, Catalog No ...
-
No products found
because this supplier's products are not listed.
Razieh Rafieenia, et al.,
bioRxiv - Microbiology 2022
Quote:
... Glyphosate concentrations were measured using a glyphosate ELISA kit (Abraxis, Eurofin Technologies, Hungary).
-
FITC conjugated recombinant Mouse Kit (NP_001116205.1) extracellular domain (Met 1-Thr 523),...
Cat# Kit-4037MF,
50ug , USD $1298
Ask
Yan Qi, et al.,
bioRxiv - Molecular Biology 2024
Quote:
... the presence of anti- Ad and anti-hemagglutinin antibodies was measured by ELISA against a purified Ad6 virus preparation (Greffex, Inc.) and a recombinant hemagglutinin protein (Creative Biomart). In the first case ...
-
No products found
because this supplier's products are not listed.
Robert J. Fialkowski, et al.,
bioRxiv - Physiology 2022
Quote:
Oxidative DNA damage was evaluated for 8-OhDG damage using a DNA damage ELISA kit (StressMarq Biosciences Inc.) (Fialkowski et al. ...
-
No products found
because this supplier's products are not listed.
Isadora Matias, et al.,
bioRxiv - Neuroscience 2021
Quote:
Protein concentration in cell extracts was measured by the BCA Protein Assay Kit (Cole-Parmer). Forty micrograms protein/lane was electrophoretically separated on a 10% SDS polyacrylamide gel and electrically transferred onto a Hybond-P PVDF transfer membrane (Millipore ...
-
No products found
because this supplier's products are not listed.
Laura N. Puentes, et al.,
bioRxiv - Neuroscience 2020
Quote:
... BioPORTER Protein Delivery Reagent “QuikEase Kit” (Genlantis, Cat#BP502424) was prepared according to the manufacturer’s protocol ...
-
No products found
because this supplier's products are not listed.
Thekla Cordes, et al.,
bioRxiv - Cancer Biology 2022
Quote:
... Supernatant was used to quantify protein using BCA protein assay kit (Cat. #G1002, Lamda Biotech. Inc) and pre-diluted Protein Assay Standards (Cat ...
-
No products found
because this supplier's products are not listed.
M. Kyle Cromer, et al.,
bioRxiv - Genetics 2021
Quote:
... The sgRNA modifications added were the 2’-O-methyl-3’-phosphorothioate at the three terminal nucleotides of the 5’ and 3’ ends described previously38. All Cas9 protein (SpyFi S.p. Cas9 nuclease) was purchased from Aldevron, LLC (Fargo ...
-
No products found
because this supplier's products are not listed.
Christophe Chapard, et al.,
bioRxiv - Genetics 2023
Quote:
... Yeast cells were synchronized in G1 by adding α-factor (Proteogenix, WY-13) in the media every 30 min during 2h30 (1 μg/mL final) ...
-
No products found
because this supplier's products are not listed.
Jeong Min Lee, et al.,
bioRxiv - Biochemistry 2024
Quote:
... supplemented with human Stem Cell Factor (SCF,100 ng/ml) (CellGenix, 1418-050), FMS-like Tyrosine Kinase 3 Ligand (Flt3L ...
-
No products found
because this supplier's products are not listed.
Toshiharu Ichinose, et al.,
bioRxiv - Neuroscience 2024
Quote:
... The ribosome-bound mRNA was eluted with 50 µl of 100 µg/ml 3× FLAG peptide (GEN-3XFLAG- 25, Protein Ark) dissolved in the lysis buffer.
-
No products found
because this supplier's products are not listed.
Ranjie Xu, et al.,
bioRxiv - Neuroscience 2021
Quote:
... CHIR99021 (3 mM, Biogems), human leukemia inhibitory factor (hLIF ...
-
No products found
because this supplier's products are not listed.
Stephanie Gehrs, et al.,
bioRxiv - Developmental Biology 2022
Quote:
HUVEC were purchased from PromoCell and cultured in Endopan 3 supplemented with 3% FCS and supplements (PAN Biotech) at 37°C ...
-
No products found
because this supplier's products are not listed.
Cellas A. Hayes, et al.,
bioRxiv - Neuroscience 2021
Quote:
... cells were grown on a T-75 flasks pre-coated with Cell Attachment Factor Solution (123-100, Cell Applications), in 15mL of RBMVEC growth medium (R819-500) ...
-
No products found
because this supplier's products are not listed.
Oriane Turrel, et al.,
bioRxiv - Neuroscience 2021
Quote:
... RNAi-RIM-BP flies have been obtained after design of the RNAi sequence by our laboratory (Forward: 5’-CTAGCAGTGGGCACCGACAATCAGCCACCT AGTTATATTCAAGCATAGGTGGCTGATTGTCGGTGCCCGCG-3’; Reverse: 5’-AATTC GCGGGCACCGACAATCAGCCACCTATGCTTGAATATAACTAGGTGGCTGATTGTG GTGCCCACTG-3’) and injection by BestGene Inc ...
-
PhotoDextran® is 1 gram of lyophilized methacrylated dextran. PhotoDextran® provides 3D...
Cat# 5333-1KIT,
1 gram, USD $325.0
Ask
Shuvasree SenGupta, et al.,
bioRxiv - Immunology 2021
Quote:
... and Purecol® (3 mg/mL, 5005, Advanced Biomatrix) in a 1:2:15 ratio ...
-
No products found
because this supplier's products are not listed.
Pavan Nayak, Arul Subramanian, Thomas Schilling,
bioRxiv - Developmental Biology 2022
Quote:
... using a BeadBug 3 Microtube Homogenizer D1030 (Benchmark Scientific), and RNA was extracted using Trizol according to the standard protocol (Invitrogen 15596018) ...
-
No products found
because this supplier's products are not listed.
Laura E. Doepker, et al.,
bioRxiv - Immunology 2019
Quote:
Immunolon 2HB ELISA plates were coated with 1 μg ml−1 ZM109 gp120 monomer or C.ZA.1197MB gp41 ectodomain (Immune Technology Corp.) in 0.1M sodium bicarbonate ...
-
No products found
because this supplier's products are not listed.
Hilal Yeter-Alat, et al.,
bioRxiv - Biochemistry 2020
Quote:
... and anti-mouse (for HA; Covalab) were used as secondary antibodies ...
-
No products found
because this supplier's products are not listed.
Yanrui Yang, et al.,
bioRxiv - Cell Biology 2020
Quote:
... mouse anti-His (CoWin Biosciences, Jiangsu, China), rabbit anti-calmodulin (Boster Biological Technology ...
-
No products found
because this supplier's products are not listed.
Jasmin N. Beaver, et al.,
bioRxiv - Neuroscience 2023
Quote:
... all mouse cages contained Nestlets (Ancare, Bellmore, NY) and huts ...
-
No products found
because this supplier's products are not listed.
Hannah I. Ghasemi, et al.,
bioRxiv - Molecular Biology 2022
Quote:
... iPSCs were then treated with 3 ml pre-warmed Accutase (Innovative Cell Technologies) and the vessel was then incubated at 37ºC for 5 min ...
-
No products found
because this supplier's products are not listed.
Michael Korenkov, et al.,
bioRxiv - Immunology 2023
Quote:
For protein complexes crystallization we used a mosquito crystallization robot (TTP Labtech) to set vapor diffusion sitting drops with 96-well iQ plates (TTP Labtech) ...
-
No products found
because this supplier's products are not listed.
Timothy N. Hoang, et al.,
bioRxiv - Immunology 2020
Quote:
... and Mouse Polink-2 HRP (GBI Labs; Cat. No. D37-110 for Mx1). Slides were developed using Impact™ DAB (3,3′-diaminobenzidine ...
-
No products found
because this supplier's products are not listed.
Zhaoyang Liu, et al.,
bioRxiv - Developmental Biology 2019
Quote:
... Histological analysis was performed on thoracic spines fixed in 10% neutral-buffered formalin for 3 days at room temperature followed by 1-week decalcification in Formic Acid Bone Decalcifier (Immunocal, StatLab). After decalcification ...